ID: 1061575946

View in Genome Browser
Species Human (GRCh38)
Location 9:131506243-131506265
Sequence TTTGAGGTCCTGAAGGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061575946_1061575953 22 Left 1061575946 9:131506243-131506265 CCCCTACCCTTCAGGACCTCAAA 0: 1
1: 0
2: 1
3: 24
4: 235
Right 1061575953 9:131506288-131506310 ATTTCTTACAGGCAGAAACCAGG 0: 1
1: 1
2: 2
3: 18
4: 275
1061575946_1061575952 11 Left 1061575946 9:131506243-131506265 CCCCTACCCTTCAGGACCTCAAA 0: 1
1: 0
2: 1
3: 24
4: 235
Right 1061575952 9:131506277-131506299 CTTATCAGTGCATTTCTTACAGG 0: 1
1: 0
2: 1
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061575946 Original CRISPR TTTGAGGTCCTGAAGGGTAG GGG (reversed) Intronic
902969052 1:20033486-20033508 TATGAGGTCCTGTAGGTTATGGG + Intronic
904300780 1:29552034-29552056 TGTGAGTTCCTTGAGGGTAGAGG - Intergenic
904457424 1:30656009-30656031 TGTGAGTTCCTTGAGGGTAGGGG + Intergenic
905787010 1:40766485-40766507 TTGGAGGGCTTGAGGGGTAGGGG + Intronic
905969020 1:42126753-42126775 TTTGAGGCACTGAAGGGAGGAGG - Intergenic
906201874 1:43965780-43965802 TGTGAGGGGCTGGAGGGTAGAGG + Intronic
906202481 1:43968923-43968945 TGTGAGGGGCTGGAGGGTAGAGG + Intergenic
906300734 1:44679903-44679925 TGTGAGTTCCTCAAGGGCAGGGG - Intronic
906855058 1:49295233-49295255 TGTGAGGTCCTGGAGAGTGGGGG - Intronic
909014052 1:70364511-70364533 TTTCAGGTCCTGATGGGAAGTGG - Intronic
909099908 1:71337154-71337176 CTTGATGGCCTGAAGGCTAGAGG + Intergenic
910551551 1:88481216-88481238 TGTGAGGTACTGAGGGTTAGAGG - Intergenic
913549998 1:119907853-119907875 TTTAAGGTCCTCAAGGGTCGAGG + Intergenic
914747907 1:150512883-150512905 TTTGAGGTACTAAAGAGAAGGGG - Intronic
915067056 1:153233425-153233447 TTTGAGGCCCTTGAGGGGAGTGG - Intergenic
916592528 1:166206274-166206296 GGGGAGGTGCTGAAGGGTAGGGG + Intergenic
916659039 1:166904042-166904064 TTTGAACTCCATAAGGGTAGGGG + Intergenic
916666002 1:166968124-166968146 TTTGTGCTCCTGAAGGCTAGAGG - Intronic
916854846 1:168738715-168738737 TTTGACTTCCTGAAGGGAAATGG - Intergenic
916933101 1:169600118-169600140 CTTCAGGTCCTGAAGGGCAAAGG + Intronic
917233845 1:172868238-172868260 ATAGAGGTCCTGATGGGGAGAGG + Intergenic
919653583 1:200175637-200175659 CTTTAGGTCCTGAGGGGCAGGGG + Exonic
920786164 1:209043546-209043568 TGTGAGATCCTTAAGGGCAGAGG + Intergenic
922749693 1:228064655-228064677 TTTGAAGTCCTGGAGGGGTGTGG + Intergenic
922943790 1:229492747-229492769 TTTGGGGACCTGAAGGGGAAGGG + Intronic
924194462 1:241591135-241591157 TTTCAGCTCCTTAAGGGTGGGGG - Intronic
924330519 1:242936415-242936437 ATTGAGCTCCTCAAGGGCAGAGG + Intergenic
1062991332 10:1822015-1822037 TTTATGGTCCTGAATGGCAGAGG + Intergenic
1065077847 10:22098726-22098748 TTTGTGGTGGTGGAGGGTAGTGG - Intergenic
1067524720 10:47031374-47031396 TTTGAGTTCTTGAAATGTAGGGG + Intergenic
1069134939 10:64752336-64752358 TTTGAGGTCATGATGGGAAGGGG - Intergenic
1069716741 10:70526003-70526025 TTTGAGGGCCTACAGGGCAGTGG + Exonic
1069726993 10:70586510-70586532 TGTGAGCTCATGGAGGGTAGGGG - Intergenic
1070626283 10:78053627-78053649 CTTCAGCTCCTGAAGGGGAGAGG + Intronic
1071800600 10:89055706-89055728 TGTGAGATCCTCAAGGGAAGTGG + Intergenic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1072552930 10:96493118-96493140 TTTGCTGTCCTGAGGGCTAGAGG - Intronic
1075142550 10:119852262-119852284 TTAAAGGTGCTGAAGGGAAGTGG + Intronic
1076184177 10:128433754-128433776 TTTGAGGTCTTGCAGGATAGAGG + Intergenic
1076914571 10:133415803-133415825 CCTGAGGTCCTGAGGAGTAGAGG - Intronic
1077867589 11:6235403-6235425 TCTGAGGTCCTGGAGAGCAGAGG - Intronic
1078319232 11:10318828-10318850 TCTGAGGTACTGAGGGTTAGGGG - Intronic
1078434841 11:11315847-11315869 TTTGAGGGGGTGCAGGGTAGTGG - Intronic
1078729051 11:13959420-13959442 TCTAAGCTCCAGAAGGGTAGGGG - Intergenic
1078800379 11:14637938-14637960 TGTGAAGTCCTGAAGGGATGTGG + Intronic
1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG + Intergenic
1082173824 11:49038644-49038666 TTTGAAGTCCTGAAAGGAAGGGG + Intergenic
1083862403 11:65428758-65428780 CTGGAGGTCCTGGAGGGTGGCGG - Intergenic
1083892504 11:65603204-65603226 ACTGAGGTTCTGAAGGGTAAGGG + Intronic
1084879888 11:72163371-72163393 TTTGATGGCCTGAAGGCAAGAGG + Intergenic
1085734682 11:79029235-79029257 TTTGAGCTCCTTAAGAGCAGAGG - Intronic
1086691944 11:89797438-89797460 ATTGAAGTCCTGAAAGGAAGGGG - Intergenic
1086713856 11:90042220-90042242 ATTGAAGTCCTGAAAGGAAGGGG + Intergenic
1089368310 11:117934658-117934680 TGGGAGGTCCTGGAGGGCAGGGG - Intergenic
1089802527 11:121046115-121046137 TATGAGGTCCTGGAGGGCACAGG - Intronic
1092130899 12:6112524-6112546 CTTGAGGTCCTGAAGGAATGGGG + Intronic
1095160156 12:38905907-38905929 CTTGCGGTCCTGGACGGTAGGGG - Intronic
1098720732 12:73894240-73894262 TTTGTTTTCCTGAAGAGTAGAGG + Intergenic
1099415415 12:82379185-82379207 TTTGAGGTGCTGTGGGGCAGTGG + Intronic
1101263261 12:103057023-103057045 TTTGAGGTCCTCATGGTTGGTGG + Intergenic
1102607793 12:114082794-114082816 TTGGAGTCCCTGAAGGGCAGGGG - Intergenic
1106384793 13:29273704-29273726 TTTCAGGGGCTGAAGGGAAGTGG - Intronic
1106615060 13:31319098-31319120 TGTGAGGTCCTGTGGGGAAGGGG - Intronic
1108297938 13:49043829-49043851 TTTGAGTTGCTGAAGGAGAGGGG - Intronic
1109811936 13:67524893-67524915 TTGCAGATCATGAAGGGTAGTGG + Intergenic
1112041041 13:95548276-95548298 CTTGAGCCCCTGAAGGGGAGGGG - Intronic
1112624919 13:101092955-101092977 TTTAAGCTCCTAAGGGGTAGGGG + Intronic
1113625791 13:111845536-111845558 TTTTAGGTCCAGAAGGGAGGTGG - Intergenic
1115295573 14:31822024-31822046 TTCGAGGTAGGGAAGGGTAGTGG + Intronic
1117126978 14:52639741-52639763 TTTAAGATTCTGAAGGGAAGGGG - Intergenic
1117164063 14:53016447-53016469 TTGGAGATCCTAGAGGGTAGAGG + Intergenic
1117551741 14:56843776-56843798 TTTGAGGTGGTGAGGGGCAGGGG + Intergenic
1118433661 14:65748753-65748775 TTTGATTTCCTGAACGGTATGGG - Intergenic
1119057132 14:71434211-71434233 TTTCAGGTCCTTAACAGTAGAGG - Intronic
1120848853 14:89150465-89150487 TTGGAGAACCTGAATGGTAGAGG - Intronic
1122056144 14:99099513-99099535 TTTCAGGCCCTGGAGGGCAGGGG + Intergenic
1122313124 14:100809917-100809939 TTTGTGGTTCTGAAGGGGAATGG - Intergenic
1123491011 15:20782905-20782927 TGTGAGGTCTTGGAGGCTAGAGG + Intergenic
1123547513 15:21351996-21352018 TGTGAGGTCTTGGAGGCTAGAGG + Intergenic
1125405015 15:39342848-39342870 CTTGAGGTTCTCAAGGGTATGGG + Intergenic
1125587166 15:40828973-40828995 CCTGGGGTCCTGAAGGGTACAGG + Intergenic
1126925238 15:53578194-53578216 TGTGAGCTCCTGAAGGGAGGGGG - Intronic
1127217286 15:56836888-56836910 TCTGAGCTCCTGGAGGATAGGGG - Intronic
1127442259 15:59021449-59021471 TTTGAGATCCAGAAGGGCATAGG - Intronic
1127648086 15:60977222-60977244 TTTGAGGTACTGGTGGGGAGGGG + Intronic
1129503986 15:76065789-76065811 TTAGAGGTCCTGATGGCTAGAGG - Intronic
1130254559 15:82319891-82319913 TTAGAGGTCATAGAGGGTAGGGG - Intergenic
1130534193 15:84771374-84771396 TTTGAGGCCCTGGTGGGTTGGGG + Intronic
1130600406 15:85270079-85270101 TTAGAGGTCATAGAGGGTAGGGG + Intergenic
1202955843 15_KI270727v1_random:79226-79248 TGTGAGGTCTTGGAGGCTAGAGG + Intergenic
1132785977 16:1657127-1657149 CTTGAGGTCCTGAAGGCTCCTGG - Intronic
1133936652 16:10274956-10274978 TTTGAAGACTTGAAGGGTAAAGG + Intergenic
1134264947 16:12684725-12684747 TATGAGCTCCTTAAGGGCAGAGG + Intronic
1136643755 16:31590914-31590936 TTGGAGGTCTGGAAGAGTAGTGG + Intergenic
1137236625 16:46623449-46623471 TTTAAGGGCCGGAAGGGCAGTGG + Intergenic
1137470240 16:48747967-48747989 TATGAGCTCCTGAAGGGCAGGGG + Intergenic
1138912647 16:61420742-61420764 TTTGAGGTTCAGAAGTCTAGGGG + Intergenic
1140047033 16:71446791-71446813 TTTCAGGTCCTGAAGGAAGGTGG - Intergenic
1140324125 16:73983892-73983914 TTTGAGGTTGGGAAGGGTTGGGG - Intergenic
1140802853 16:78505126-78505148 TTTGAAGTTCTGAAGAGTGGGGG - Intronic
1142496243 17:307524-307546 TATGAGCTCCTGGAGGGCAGGGG + Intronic
1143303633 17:5929160-5929182 TGTGACGTCCTTAAGGGCAGAGG + Intronic
1143951097 17:10632838-10632860 TTTGTTATCCTGCAGGGTAGTGG - Intronic
1144286767 17:13784855-13784877 TTTGAGGTGGTGAAGACTAGGGG - Intergenic
1144708558 17:17385748-17385770 TTTGAGGTCCTTGAGGTCAGAGG - Intergenic
1144784034 17:17822072-17822094 TTTGAGGTAGTCTAGGGTAGTGG - Intronic
1147055787 17:37833775-37833797 TTGGAGGGACTGAAGGGGAGGGG + Intergenic
1149730962 17:58945816-58945838 GGTGAGGTCCTGAAGGGGAAGGG + Intronic
1150880545 17:69020953-69020975 TTTATGTTCTTGAAGGGTAGAGG - Intronic
1151895148 17:76975012-76975034 AGGGAGGTCCTGAAGGCTAGGGG + Intergenic
1152380470 17:79939833-79939855 TCACAGGTCCTGAAGGGAAGTGG + Exonic
1154999320 18:21671051-21671073 TGTGAGGTCCTAAAGGACAGGGG - Intronic
1155651808 18:28152376-28152398 CTTGAGCTCCTTAAGGGCAGGGG - Intronic
1155691329 18:28627850-28627872 TTTGAAGTCTTGAAAGCTAGGGG - Intergenic
1157162461 18:45326557-45326579 TTTGAGTTCCAGGAGGGTAGGGG - Intronic
1158105680 18:53882755-53882777 TTTGAGGTCCTTGTGGGGAGGGG - Intergenic
1161808882 19:6460103-6460125 CTTGAGTTCCTGAAGATTAGTGG - Intronic
1163491203 19:17618080-17618102 CTTGAGGTGTAGAAGGGTAGAGG - Intronic
1163507908 19:17719347-17719369 TTTGAGGTCGTGGAGAGCAGGGG - Exonic
1164614755 19:29660344-29660366 TGTGAGCTCCCCAAGGGTAGAGG + Intergenic
1164764602 19:30754437-30754459 TGTGAGTTCCTGGAGGGTGGAGG + Intergenic
1165320828 19:35084215-35084237 CTTGGGGTCCTGGAGGTTAGAGG - Intergenic
1167037326 19:47002067-47002089 TTTGAGGTGCTGGGGGGCAGAGG - Exonic
1167059460 19:47134602-47134624 TCTGAGATCCTAAAGGGTTGGGG + Intronic
927187453 2:20492028-20492050 TGTGATGTGCAGAAGGGTAGGGG + Intergenic
927627917 2:24743065-24743087 TTTCAGGTTCTGATAGGTAGTGG + Intronic
928965730 2:36973420-36973442 ATTGAGGGCCTGGAGAGTAGAGG - Intronic
931323146 2:61192241-61192263 TTTCAGGGACTGAAAGGTAGTGG + Intronic
932570392 2:72935477-72935499 TTTGAGGTGCTGAGGGGCAGGGG - Intronic
933348792 2:81126567-81126589 TTTAAGGTGCTGAAGGGGTGGGG - Intergenic
936709841 2:115119783-115119805 TTTGATGGCCTGAAGGCAAGAGG + Intronic
938224511 2:129604432-129604454 TTTGTGGTCCTGCAGGGATGGGG - Intergenic
940043338 2:149384023-149384045 TGTGAGCTGCTCAAGGGTAGAGG + Intronic
940188589 2:151014442-151014464 TACGACTTCCTGAAGGGTAGAGG - Intronic
941919678 2:170837474-170837496 TCTGAGGTCCTGTAGGGTATGGG + Intronic
943469931 2:188281960-188281982 TGTGAGCTCCTTAAGGGTAGAGG + Intergenic
945415065 2:209560586-209560608 TTTGAGAGCCTGAGGGGTGGGGG - Intronic
945598180 2:211822132-211822154 TTAGAGGTTGGGAAGGGTAGGGG + Intronic
945665365 2:212734780-212734802 TTTGGGGTCCTTCAGGGTAGAGG - Intergenic
947108774 2:226696321-226696343 TGTGAGGCCCTGAACGGTATTGG + Intergenic
947602864 2:231465121-231465143 CTTGAGGTTCTGTGGGGTAGGGG - Intronic
948963475 2:241357484-241357506 TTTGAGGTCCTTAAAGGTTTAGG + Intronic
1169837382 20:9895521-9895543 TGTGAGCTCCTGAAAGGGAGGGG + Intergenic
1169886411 20:10403395-10403417 TTTGAGGATCTGAGGAGTAGGGG - Exonic
1171020281 20:21578378-21578400 TTTGGGGTGCTGAAGGGCACTGG + Intergenic
1171185782 20:23123147-23123169 TTTGAGCTGCTGCAGGGTTGGGG + Intergenic
1172052434 20:32128584-32128606 TTGGAGGCTCTGAAGGGTAGGGG - Intronic
1174602031 20:51732469-51732491 TTTAAGGTCCTGATGGACAGAGG - Intronic
1175154851 20:56963769-56963791 TTTGTGGTTCTGCAGGGCAGGGG - Intergenic
1176383666 21:6126523-6126545 GGGGAGGTCCTGATGGGTAGAGG + Intergenic
1176929807 21:14795480-14795502 TTTCAGGTCCTTGGGGGTAGGGG - Intergenic
1177592089 21:23184477-23184499 TTAGTGTTCCTGAAGAGTAGGGG - Intergenic
1177668347 21:24191534-24191556 TTTGAGGACCTAAAGGAGAGAGG + Intergenic
1179077768 21:38140053-38140075 CATGAGGTCCTGGAGGTTAGAGG + Intronic
1179333049 21:40424230-40424252 TTTGAGATACTGCAGGTTAGGGG - Intronic
1179739804 21:43411715-43411737 GGGGAGGTCCTGATGGGTAGAGG - Intergenic
1179956859 21:44745667-44745689 TTTGATGGCCTGAAGGCGAGAGG - Intergenic
1181257510 22:21573445-21573467 GTTGAGCTCCTCAAGGGCAGAGG - Intronic
1181298363 22:21860621-21860643 TTTGAGCTCCAAAAGTGTAGAGG + Intronic
1181549678 22:23630367-23630389 TTTGACCTCCTGAATGGAAGAGG - Intronic
1182760550 22:32719117-32719139 TTTGAGGTCCTGGGGAGGAGGGG + Intronic
1183608164 22:38879083-38879105 TTTGAGGTCCTGGAGGGCTGGGG + Intergenic
954276008 3:49542153-49542175 TTTCAGGGGCTGAAGGGGAGGGG - Intergenic
954786034 3:53093120-53093142 TGTGAGGTACTGAAGCTTAGGGG - Intronic
954801306 3:53188707-53188729 TTTGAGGTCCCTAAGGACAGGGG - Exonic
956918137 3:73895959-73895981 TTTGAGATCCTGAAGGGAAAAGG + Intergenic
957372243 3:79310075-79310097 TCTTAGGCCCTGAAGGGTAAAGG + Intronic
961674327 3:128555560-128555582 TTTGAGGACAGGAAGGGGAGAGG + Intergenic
961749745 3:129088147-129088169 TTTAAGGGCCGGAAGGGCAGTGG + Exonic
962270796 3:133976736-133976758 TTTGAGATGTTGAAGGGCAGGGG - Intronic
962532832 3:136299069-136299091 TTGGAGTTCCTGAAGGGTTTAGG + Intronic
962605329 3:137028004-137028026 TTGGAGTTCCAGAAGGGGAGAGG + Intergenic
963043195 3:141083914-141083936 CTGGAGGCCCTGCAGGGTAGAGG + Intronic
963760356 3:149281949-149281971 TTTCAGGCCTTGAAGGGCAGCGG - Intergenic
964578763 3:158206423-158206445 TTTGAGGGACTGAAGTCTAGTGG + Intronic
966203256 3:177378914-177378936 TTTGTGCTTCTGAAGGGGAGAGG + Intergenic
976926760 4:90507725-90507747 TTAGAGGCCCTGAAGAGAAGTGG - Intronic
977480722 4:97571370-97571392 TTTCAGGCCATGAAGGGAAGTGG + Intronic
977626036 4:99190703-99190725 TAGGAGGTGCAGAAGGGTAGGGG + Intergenic
978778899 4:112529643-112529665 TTTCATGTCCTTAAGGGTAGGGG + Intergenic
980564193 4:134517358-134517380 TTTAAGATCCTGAATGGTAAAGG + Intergenic
981480771 4:145236982-145237004 TTTCAGCTCCTGAGGGGCAGAGG + Intergenic
981637436 4:146897235-146897257 TTTGAAGACCTGAGAGGTAGGGG + Intronic
981840945 4:149111188-149111210 TTTGAGGTCCAAAATGGGAGGGG - Intergenic
982591173 4:157313536-157313558 TTTAAGGTCTTTCAGGGTAGGGG + Intronic
983379922 4:166979934-166979956 TTTGAGGAACTGAAGGGAAGGGG - Intronic
984001193 4:174247413-174247435 TTTGATGACCTGAAAAGTAGTGG - Intronic
984137437 4:175958449-175958471 TTTATGGTTCTCAAGGGTAGTGG - Intronic
985126852 4:186703051-186703073 TGTGAGGTCTGGAAGGGGAGAGG - Intronic
986022424 5:3817020-3817042 TTTGATGTCATGAAGAGCAGTGG + Intergenic
986416269 5:7531071-7531093 TCTGAGCTCCTGAAGGTTAATGG + Intronic
991643136 5:68774427-68774449 TTAGAAGTCCTGAAGTGTACAGG - Intergenic
991956702 5:72001906-72001928 TTTGAGTTCCTTGAAGGTAGAGG + Intergenic
992453453 5:76894019-76894041 GTTCAGGTCATGAAGGGAAGTGG + Intronic
993453168 5:88097390-88097412 TATGATGTCATGAAGGTTAGTGG + Intergenic
993710000 5:91215244-91215266 ATTCAAGTCCAGAAGGGTAGAGG + Intergenic
996030012 5:118694218-118694240 TTAGAGCTGCTGAAGGCTAGTGG + Intergenic
996450873 5:123623138-123623160 TATGAGGCTTTGAAGGGTAGCGG - Intergenic
999306728 5:150524376-150524398 TGTGAGATCCTGGAGGGTGGTGG + Intronic
1000271841 5:159692909-159692931 TTAGAGGTCGGGAAGGGTATGGG + Intergenic
1001401388 5:171448491-171448513 CTTGACGTCCTGAAAGGCAGGGG + Intronic
1005342085 6:24852523-24852545 ATTATGGACCTGAAGGGTAGGGG - Intronic
1005576820 6:27197685-27197707 TTTGAGGTCTGGAAGAGTGGAGG - Intergenic
1017180135 6:151544268-151544290 TTAGAGATCCTAAAGGGTTGAGG + Intronic
1017969470 6:159299247-159299269 TTGGAGGTCCTGCAGGCCAGCGG - Intergenic
1018474019 6:164122592-164122614 TCTGAGGTACTGAGGGTTAGGGG - Intergenic
1019316914 7:391117-391139 GCTCAGGGCCTGAAGGGTAGGGG + Intergenic
1019495430 7:1337301-1337323 TTGGAGTTCCTGAAGGAGAGGGG - Intergenic
1019749821 7:2722048-2722070 TTTAAGGTCCTGAAAGGCACAGG + Intronic
1020458779 7:8404521-8404543 TTTCAGGTACTGAAGGGAGGGGG + Intergenic
1020919344 7:14242743-14242765 TTGGAGGTTATGAAGGGTATAGG - Intronic
1020976625 7:15014454-15014476 AATGAGGTCCTAAAGGGAAGTGG + Intergenic
1022178995 7:27899827-27899849 TTTGAGGTCATTTAGGATAGTGG + Intronic
1023688712 7:42763885-42763907 TCTGATATCCTGGAGGGTAGAGG + Intergenic
1029482072 7:100819486-100819508 ACTGAGGGCCTGAAGGGGAGAGG - Intronic
1030363334 7:108618631-108618653 TTTGTTGTCCTGTAGGTTAGAGG + Intergenic
1031469160 7:122148241-122148263 TGTGAGGTCCTGAAAGGTAGTGG + Intergenic
1033074838 7:138239254-138239276 TCTGAGATCCTGGAGGCTAGGGG + Intergenic
1034671283 7:152860361-152860383 TTTGGGAACCTGAAGAGTAGAGG + Intergenic
1035081037 7:156216143-156216165 TTTGAGGACCTCGAGGTTAGAGG - Intergenic
1036455088 8:8899566-8899588 TCTGAACTCCTGAAGGGTAAAGG - Intergenic
1038235425 8:25748447-25748469 TTTGAGGTCATGAAGACTGGTGG + Intergenic
1039736182 8:40335407-40335429 TTTCAGGTCATGATGGGAAGTGG - Intergenic
1041678045 8:60556199-60556221 TTAGAGGCCGGGAAGGGTAGGGG + Intronic
1042820359 8:72923554-72923576 TTTCAGGTCATGATGGGAAGTGG - Intronic
1042874280 8:73426467-73426489 TTAGAGGTTGGGAAGGGTAGGGG - Intronic
1044146680 8:88724788-88724810 TTTGAGGTCCTTAATGGTGAAGG + Intergenic
1045008446 8:97936453-97936475 TTTGAGGTCCTGATGTGAAGTGG + Intronic
1046531927 8:115457441-115457463 TTTCAGGTGCTGAAGGGAGGAGG + Intronic
1047048495 8:121082114-121082136 TTAGAGGCTGTGAAGGGTAGAGG - Intergenic
1047186868 8:122641399-122641421 TATGAACTCCTGTAGGGTAGAGG - Intergenic
1048000508 8:130375931-130375953 TCTGATGTCCTGAGGAGTAGTGG + Intronic
1048007331 8:130430100-130430122 TTTGAGGTCCAGAAGGATCGGGG - Intronic
1048209243 8:132441147-132441169 TTTGAGGTCTTCAAGTGTTGGGG - Intronic
1048466026 8:134665314-134665336 TTTCAGGCCCTCAAGGGAAGGGG + Intronic
1051940699 9:22502216-22502238 TTTAAGGGCCTAAAGGGAAGTGG - Intergenic
1052012511 9:23427112-23427134 TTTGTGGTCCTGAAAAGGAGTGG - Intergenic
1052025647 9:23570718-23570740 TTTGAGAGCCTGAACTGTAGAGG - Intergenic
1054803777 9:69378859-69378881 TGTGAGCTCCTTAATGGTAGAGG - Intronic
1055682442 9:78730716-78730738 TTTGAGGCCAAGAAGGGTAGGGG + Intergenic
1056723028 9:89087760-89087782 GTTCAGGTCCTGATGGGAAGAGG + Intronic
1056948906 9:91026204-91026226 TGTGAGGTCCTGAGGGGCAGTGG - Intergenic
1058802952 9:108562542-108562564 TGTGAGCTCCTTAAGGGCAGGGG - Intergenic
1059295659 9:113268006-113268028 TGTGACATCCTGGAGGGTAGGGG - Intronic
1059463956 9:114453878-114453900 TTTGTGTTCATGAAGGATAGTGG - Intronic
1061575946 9:131506243-131506265 TTTGAGGTCCTGAAGGGTAGGGG - Intronic
1187277298 X:17827316-17827338 TCTGAGTTCCAGGAGGGTAGGGG + Intronic
1189770345 X:44419192-44419214 TGTCAGGGGCTGAAGGGTAGGGG + Intergenic
1190212795 X:48461078-48461100 TTGGAGGGCCTGAGGTGTAGAGG + Exonic
1192082093 X:68058304-68058326 TTTGAGCTCCTAGAGGGCAGGGG - Intronic
1194256604 X:91643100-91643122 TTTCAGGCCATGAAGGGAAGTGG + Intergenic
1194973625 X:100371391-100371413 TTTGGGCTCCAAAAGGGTAGGGG + Intronic
1196189269 X:112778012-112778034 TTTGGGGTGCAGAAGGGTACTGG - Exonic
1198077431 X:133207214-133207236 TATAAGCTCCTGAAGGGCAGGGG + Intergenic
1198514372 X:137389905-137389927 TTTGGGGTACTGAGGGGAAGGGG - Intergenic
1198816554 X:140597888-140597910 GTTGAAGCCCTGAAGAGTAGGGG - Intergenic
1199721594 X:150546569-150546591 TTTGAGCTCCTGGAGGATAGGGG - Intergenic
1199722142 X:150549587-150549609 TTTGAGGTCAAGTAGGGGAGGGG + Intergenic
1200575323 Y:4882378-4882400 TTTCAGGCCATGAAGGGAAGTGG + Intergenic
1201227876 Y:11835548-11835570 ATTGAGCTCCTCAAGGGCAGAGG + Intergenic
1201947362 Y:19526487-19526509 TCTGAGGCCCTGAAGGGCTGAGG - Intergenic