ID: 1061578170

View in Genome Browser
Species Human (GRCh38)
Location 9:131520698-131520720
Sequence GCTCGGGGTGGGGCGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061578170_1061578178 7 Left 1061578170 9:131520698-131520720 CCAGAGGCCGCCCCACCCCGAGC 0: 1
1: 0
2: 2
3: 26
4: 366
Right 1061578178 9:131520728-131520750 GCACTTTGCATTCTCCTCCGTGG No data
1061578170_1061578181 30 Left 1061578170 9:131520698-131520720 CCAGAGGCCGCCCCACCCCGAGC 0: 1
1: 0
2: 2
3: 26
4: 366
Right 1061578181 9:131520751-131520773 ACAGCGCTGCTGTTACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061578170 Original CRISPR GCTCGGGGTGGGGCGGCCTC TGG (reversed) Intronic
900545758 1:3228334-3228356 TCTGGGGGTGGGGCTGCCTGGGG - Intronic
900827944 1:4941534-4941556 GCCAGGGGTGGGGCGGGCTGCGG - Intergenic
900950961 1:5858178-5858200 GCCCAGGGTGGGGTGGCCTGAGG - Intergenic
901019929 1:6250360-6250382 GCTCCGAGTGGAGAGGCCTCGGG + Intronic
901045522 1:6393494-6393516 GCTCGGGGTGGGGCCGGCGCGGG - Intronic
901242311 1:7702808-7702830 GCTGGGGTTGGGGTGGCTTCTGG - Intronic
901472627 1:9468197-9468219 GCGAGGGATGGGGCGGTCTCTGG - Intergenic
901492466 1:9603443-9603465 GCCCGGTGAGGGACGGCCTCGGG - Intronic
901506589 1:9689471-9689493 GCTGGGGGCGGGGCGTCCTCGGG - Intronic
902238651 1:15073985-15074007 GCTGGGGGTGGTGGGGCTTCTGG - Intronic
902925598 1:19693887-19693909 GCCCTGGGTGGGGGGGACTCGGG + Intronic
903330779 1:22596060-22596082 GCTAGGGGTGGCCTGGCCTCAGG + Intronic
903639559 1:24848856-24848878 CCACGGGGAGGGACGGCCTCGGG + Intergenic
904063056 1:27726164-27726186 GCGCGGGCTGGGGCGGCGGCCGG + Intronic
904265781 1:29317928-29317950 GCTTGGGGTGGAGTGGGCTCTGG + Intronic
906518559 1:46453765-46453787 GCTGGGGGTGGGGCTGCCCTGGG + Intergenic
906675229 1:47688423-47688445 GCCCGGGGTGGGGTTGCCTGTGG - Intergenic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
915311909 1:155009272-155009294 GATCGGGCTGGGGTGTCCTCTGG + Intronic
915348284 1:155209050-155209072 CCTCGGGGGAGGGCGGCCGCCGG - Exonic
915348956 1:155212845-155212867 GCTGGGGCTGGGGCTGGCTCAGG + Intronic
915352143 1:155233471-155233493 GCTGGGGCTGGGGCTGGCTCAGG + Intergenic
915474906 1:156147576-156147598 ACTGGGGGAGGGGCAGCCTCAGG + Intronic
916212031 1:162367252-162367274 GCTGGGGGCGGGGTGTCCTCGGG - Exonic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
917520267 1:175742578-175742600 GCTCAGGCTGGGGCGGCTTTGGG - Intronic
921152738 1:212414782-212414804 CCGCGGGCTGGGGCGGTCTCAGG - Exonic
922059432 1:222073706-222073728 GCTTGGGATGGGTAGGCCTCTGG + Intergenic
922160733 1:223077752-223077774 GCTGGGTGTGGCGAGGCCTCCGG + Intergenic
922250659 1:223846029-223846051 CCTGGGGGAGGGGCGGCCGCGGG + Intergenic
922568778 1:226619390-226619412 GCTCAGGGAGGGGTGGGCTCTGG - Intergenic
1063005317 10:1964790-1964812 GCTCGGTGTGGGGTGGACACTGG + Intergenic
1063201140 10:3785821-3785843 GTTGGGGACGGGGCGGCCTCGGG - Intergenic
1065726075 10:28668878-28668900 GGCCGGGGAGGGGCGGGCTCGGG + Intergenic
1066986910 10:42475999-42476021 GCGCCGGGGAGGGCGGCCTCAGG + Intergenic
1067081835 10:43216620-43216642 TCTCTGGGTGGGGCAGCCCCTGG - Intronic
1067222797 10:44356236-44356258 GCTCGGAGTGGGGCATCTTCTGG - Intergenic
1067436563 10:46282983-46283005 GCTCGGGCTGGGCCGGGCGCCGG - Intergenic
1067839747 10:49666220-49666242 GCTGGGGCTGGGGCTGACTCTGG - Intergenic
1070139803 10:73730671-73730693 GGGCGGGGTGGGGCGGAATCGGG - Intergenic
1070886529 10:79904814-79904836 GGGCGGGGTGGGGCGGAATCCGG + Intergenic
1071439753 10:85679857-85679879 GCAGGGGGTGGGGCTGCCTCAGG - Intronic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1072757376 10:98030227-98030249 GCTGGGGGTGAGGCGGCGGCCGG - Intronic
1072783987 10:98268234-98268256 GCTCGGGGCTGGGGGGCCGCGGG - Exonic
1074288295 10:112119169-112119191 GCTGGGGGTGGGGCTTGCTCAGG - Intergenic
1074756426 10:116627488-116627510 GCTGGGGGTGGGGCAGTCCCGGG + Intronic
1076355318 10:129848343-129848365 GCTCATGGTGGGGCCGCCACTGG - Intronic
1076847319 10:133075658-133075680 GCTGGGGCTGGGGCGGCCCACGG + Intronic
1076980310 11:200649-200671 GGTGGGGGTGGGGTGGGCTCTGG - Intronic
1077095241 11:796295-796317 GGGCGGGGTGGGGCGGGCTTGGG + Exonic
1077110641 11:860596-860618 GGTGGGGGTGGGGCGGCTGCTGG + Intronic
1077184120 11:1228836-1228858 ACTGGGGGTGGGGAGGCCTGGGG + Intronic
1077232196 11:1462878-1462900 CCTCAGGCTGGGGCAGCCTCGGG - Intergenic
1077307442 11:1874475-1874497 GTTCAGGGTGGGGTGGGCTCTGG + Intronic
1077322111 11:1947183-1947205 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1077467483 11:2740457-2740479 CCTCTGGGTGGGGCTGCATCGGG - Intronic
1077476297 11:2792043-2792065 GAACGGGGTGGGGAGGGCTCAGG - Intronic
1077938128 11:6812484-6812506 GCTGGGAGTGGGGAGGTCTCAGG + Intergenic
1078891322 11:15561010-15561032 ACTCGGAGCGGAGCGGCCTCGGG + Intergenic
1080386091 11:31811934-31811956 GCTTGGGCTGGGGAGGCCTCTGG - Intronic
1081666070 11:44917910-44917932 GCAGGGGATGGGGCGGCCACTGG - Intronic
1083540004 11:63506000-63506022 GCTGGGGGTGGGGCTGTTTCTGG + Intergenic
1083571493 11:63764134-63764156 ACTCGGGGCGGGGCGGCCCCAGG + Exonic
1083626546 11:64074813-64074835 GCTTGGGGTGGGGAAGCCTGTGG + Intronic
1083939569 11:65888426-65888448 GCTCGGGGCGCTGCGGCCCCGGG - Exonic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084588910 11:70079000-70079022 GCCCCGGGTGAGGCGGCTTCGGG - Intronic
1084608342 11:70185471-70185493 GCTTGGTGTGCGGCTGCCTCCGG - Intronic
1084709618 11:70835941-70835963 GCTCGGGGTGCAGTGGGCTCGGG - Intronic
1084771969 11:71349244-71349266 GCTGGGGATGGGGCGGCTTGAGG - Intergenic
1085050159 11:73376285-73376307 GCTCGGGGTGAGTCGGGCGCGGG + Exonic
1085337358 11:75706382-75706404 GCCCAGCGTGGGGCGGGCTCAGG - Intergenic
1086584036 11:88431702-88431724 GCTGGGGGTGGGGTGGCAGCGGG + Intergenic
1087672950 11:101128322-101128344 GCTCTGGGTGGCGCGGCGGCTGG - Exonic
1089216030 11:116835312-116835334 GGACGGAGCGGGGCGGCCTCAGG - Intergenic
1089258037 11:117204376-117204398 GCTGGGGGAGGGCCGGGCTCAGG - Exonic
1089556230 11:119317190-119317212 GCGCGGGGCGGGGCGGGCCCGGG - Intronic
1090048689 11:123358606-123358628 GCTCGGGTTTGGGTGTCCTCAGG + Intergenic
1091358702 11:134957759-134957781 GCTGTGGGAGGGGCGGCCTCTGG - Intergenic
1202805127 11_KI270721v1_random:2496-2518 GCGCGGGGCGGGGCGGGCGCAGG + Intergenic
1092046204 12:5433130-5433152 GCCCAGGGTGGGGTGGCCACCGG - Intronic
1093094986 12:14961501-14961523 CCTCGGGCTGGGGAGGCTTCAGG - Intronic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1095581599 12:43806358-43806380 TCACGGGGCGGGGCGGCCGCGGG - Intronic
1096159860 12:49367410-49367432 GGTGGGGGCGGGGCGGCGTCCGG + Intronic
1096215942 12:49797333-49797355 GCTGGGGGTGGGGCGGCTGGGGG + Exonic
1100351503 12:93788187-93788209 TCTCAGGCTGGGGAGGCCTCGGG + Intronic
1101193164 12:102355479-102355501 CATAGGGGTGGGGAGGCCTCAGG + Intergenic
1101875970 12:108597248-108597270 GGTGGGGGTGGGGCAGCCCCCGG - Intronic
1102182136 12:110920675-110920697 GCATGGGGTGGGGGGGCCTTAGG - Intronic
1102492734 12:113298667-113298689 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
1102644636 12:114396184-114396206 GCCCGGGGTCGGGCAGCCGCGGG - Intronic
1103120668 12:118376906-118376928 GAGAGGGGCGGGGCGGCCTCCGG + Intronic
1103322814 12:120101767-120101789 GCTTGGGAAGGGGCGGCCTGTGG - Intronic
1103562508 12:121800058-121800080 GCTGGGGGAGGGGCGGCGTCTGG - Intronic
1103800595 12:123534428-123534450 GCTCGGGGAGGCGCGCCCTGGGG - Intergenic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1104048867 12:125183447-125183469 GCAGGGGGTGGTGCGGCCTGAGG + Intergenic
1104289647 12:127455836-127455858 GCTGGGGCTGGGGCGGCTGCGGG + Intergenic
1104568398 12:129904316-129904338 GCTGGGCGTGGGGCGGCCAGGGG - Intergenic
1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG + Intronic
1106890630 13:34241846-34241868 GCTGGGGTAGGGGAGGCCTCTGG + Intergenic
1107938270 13:45363117-45363139 GCTGGGGATGGGCCTGCCTCTGG - Intergenic
1108540624 13:51441801-51441823 GCTGGAGGTGGGGAGGCCTGGGG - Intronic
1109058480 13:57582319-57582341 CCTCGCGGTGGGGCCCCCTCAGG + Intergenic
1109439316 13:62349186-62349208 GCTGGGGGTGGGGCTTCCTTTGG - Intergenic
1112344213 13:98576899-98576921 GCCAGGGCTGGGGTGGCCTCGGG - Intronic
1113610947 13:111644879-111644901 GCACCGGGAGGGGCGGCCCCAGG + Intronic
1113613788 13:111666385-111666407 CCTCTGGGTGGGGAGACCTCGGG - Intronic
1113656726 13:112072505-112072527 CGGCGGGGTGGGGCGGCGTCAGG + Intergenic
1113664480 13:112131766-112131788 CCTGGGTGTGGGGCCGCCTCGGG + Intergenic
1113944264 13:114034830-114034852 GCTCGGGGTGGAGGGGAATCTGG + Intronic
1114267223 14:21080073-21080095 GCTGGGGGTGGGACAGCCTGAGG - Intronic
1114616745 14:24072497-24072519 GCAGGGGGTGGAGAGGCCTCTGG - Intronic
1116166571 14:41341410-41341432 ACTAGGGTTGGGGAGGCCTCAGG + Intergenic
1116886895 14:50231168-50231190 GCTAGGGGCGGGGCGGCCGGCGG - Intronic
1118339207 14:64880201-64880223 GCTCGGGGTGGCGCGGGGTTAGG - Intergenic
1118372813 14:65152212-65152234 TCTGGGGGTGGGGGGGCCTGTGG + Intergenic
1119322336 14:73739423-73739445 GCTGGAGGTAGGGCGGCCCCAGG - Exonic
1119481729 14:74962268-74962290 GCTCGGGGCGGTCCCGCCTCGGG + Intergenic
1119936140 14:78594016-78594038 GCTCTGGGTGGGGTGGCCTGGGG - Intronic
1121241801 14:92436112-92436134 GATGGGGATGGGGAGGCCTCAGG + Intronic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1122136584 14:99636297-99636319 GGTGGGGGTGGGGCAGCATCTGG + Intergenic
1122778648 14:104134396-104134418 GATGGGGGTGGGGTGGGCTCTGG + Intergenic
1122873031 14:104650265-104650287 GCTCCGGGTGGGGAGGCCGAGGG + Intergenic
1122940396 14:104978529-104978551 GCGCGGGGTGGGGCGGGGCCTGG - Intergenic
1124629219 15:31327503-31327525 GCTCGGGGGCGGGCGGCGGCAGG - Exonic
1125511102 15:40292854-40292876 GCACAGGGTGGGGCAGCTTCTGG - Intronic
1125598005 15:40899776-40899798 GCTAGGGGTGGGCTGGCCCCAGG - Exonic
1125834525 15:42737392-42737414 GCTGGGAGTGGGGCTGCCGCGGG + Intergenic
1125999343 15:44194848-44194870 GCTGGGGCTGGGGCGACCCCTGG + Intronic
1126968400 15:54082949-54082971 GCTCCGGGTGTGGAGGTCTCAGG + Intronic
1127382107 15:58438911-58438933 GCTAGGGGTGGGGAGGCATGGGG + Intronic
1127988743 15:64095844-64095866 GCTGGGGGCGGGGCGGCACCCGG - Intronic
1128635273 15:69298865-69298887 GCGCGGGGCGGGGCGGCCCCGGG - Intergenic
1129252645 15:74317458-74317480 GCACAGGGTTGGGGGGCCTCTGG - Intronic
1130547582 15:84868220-84868242 GCTTGGGGGTGGGCCGCCTCCGG - Exonic
1131112874 15:89776419-89776441 GCTGGGGCTGGGCCGGCCACTGG + Exonic
1132469363 16:93358-93380 GCTCCCGGTGGGCCAGCCTCAGG - Intronic
1132682064 16:1146474-1146496 CCTAGGGGTGGGGCTGCCTCTGG - Intergenic
1132689559 16:1176495-1176517 GCTCGGGCTGAGGAGGCCTGGGG + Intronic
1132826359 16:1907535-1907557 GGTCAGGGTGAGGCGGGCTCTGG - Intergenic
1132904135 16:2273566-2273588 CCTCGCGGTGGGGCGGGCCCAGG - Intergenic
1132945077 16:2527997-2528019 GCTCGGGGTGGGCCTGCTTGGGG + Intronic
1133128886 16:3664243-3664265 GCGGTGGGTGGGGCGGGCTCCGG - Exonic
1133136756 16:3717578-3717600 GCGCGGGGCGGGGCTTCCTCGGG + Exonic
1133188372 16:4116078-4116100 GCTGGGGGTGGGGGCGCCCCGGG + Exonic
1133271579 16:4613230-4613252 CCTCCGGGTGGGGCTGCCTTGGG + Intronic
1133325061 16:4937180-4937202 GCTGGGGGCGGGGCGCCCGCCGG + Intronic
1137988504 16:53130590-53130612 GCTTGGGGCCGGGCGCCCTCTGG - Intronic
1137988688 16:53131193-53131215 GGCCGGGCGGGGGCGGCCTCAGG - Intronic
1138584958 16:57963557-57963579 GCTGGGGCTGGGCTGGCCTCAGG - Intronic
1139413536 16:66786860-66786882 GGTGGGGGTAGGGCAGCCTCAGG - Intronic
1139475050 16:67198998-67199020 ACTAGGGGTGGGGCGGCCTCCGG + Intergenic
1140091930 16:71846003-71846025 GCTGGGTGTGGGGCGGCTCCGGG + Exonic
1140406233 16:74713452-74713474 GGACGGGGTGGGGCTGCCACTGG + Exonic
1141486688 16:84344905-84344927 CCTCGGTGTGGGGCAGCCACGGG + Intergenic
1141994233 16:87626634-87626656 GCTCTGAGTGTGGCGGCCTCAGG - Intronic
1142285323 16:89169316-89169338 GCTGGGGGTGGGGGGACCTCTGG + Intergenic
1142411272 16:89918398-89918420 GCGCGGGGTGAGGGGGCTTCCGG - Exonic
1143508805 17:7384176-7384198 CTTCGGGCTGGTGCGGCCTCTGG + Exonic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1145828200 17:27893213-27893235 GCTAGGGATGTGGAGGCCTCGGG - Intronic
1145992453 17:29087194-29087216 GCTCTGGGTGAGGAGGCCTGGGG + Intronic
1146163009 17:30570048-30570070 GCTCAGGGTGGGGCAGTCCCAGG - Intergenic
1146255602 17:31390325-31390347 CCTCTGGGTGGGGCTTCCTCTGG + Intergenic
1147583232 17:41638469-41638491 GATCTGGGTGGGGCCGCCTGGGG - Intergenic
1147717988 17:42520920-42520942 GCTCGGGGTGAGGTGGGCACGGG + Intronic
1147968192 17:44205543-44205565 GCTGGGGGTGGGGAGGCCTGGGG - Exonic
1148419252 17:47531657-47531679 GGTCGGGGCTGGGCGGCCGCAGG + Intronic
1148471414 17:47896185-47896207 GCTCGGGCGGTGGCGGGCTCCGG + Exonic
1150236980 17:63601176-63601198 GCTCGGGGTGGGAGGGCCGGGGG - Exonic
1150693489 17:67384357-67384379 GATCAGGGTGGTGCTGCCTCTGG + Intronic
1150743307 17:67797018-67797040 GCTGGGGGTTGGGCCTCCTCTGG + Intergenic
1151472330 17:74326123-74326145 GCGCGGGGAGGGGCGGGCGCCGG + Intergenic
1151480723 17:74368870-74368892 GCACAGGGTGGGGCATCCTCTGG - Intronic
1151842718 17:76629130-76629152 GCAGGGGGTGGGGTGGCCTGAGG + Exonic
1151881850 17:76900539-76900561 GGTCGGGGTGGAGCAGCCACGGG + Intronic
1152685896 17:81693760-81693782 GGGTGGGGCGGGGCGGCCTCAGG + Intronic
1152735613 17:81995583-81995605 GCTCGGGGTGGGCAGGGATCGGG - Intronic
1152748322 17:82051387-82051409 GCGCGGGGCGGGTCGGTCTCCGG - Intronic
1152867954 17:82735517-82735539 GCGGCGGGAGGGGCGGCCTCAGG - Intergenic
1153688162 18:7567112-7567134 GCGCGGGGAGGAGCGGCCACCGG - Exonic
1154279714 18:12991556-12991578 GCAGGCTGTGGGGCGGCCTCAGG + Intronic
1154496253 18:14963460-14963482 GCTGATGGAGGGGCGGCCTCTGG + Intergenic
1156231257 18:35155918-35155940 GCCAGGGGTGGGGTGGCCTGTGG - Intergenic
1157300317 18:46474371-46474393 GCAGGGGGTGGGGAGGCCTGTGG + Intergenic
1157620031 18:49011607-49011629 GCCAGTGGAGGGGCGGCCTCTGG + Intergenic
1160041829 18:75352521-75352543 GGGCGGGCTGGGGAGGCCTCAGG - Intergenic
1160707666 19:536976-536998 GGTCGGAGTGGGGCGGCCCGGGG - Intronic
1160715072 19:572792-572814 CCTCGGCGCGGGGCGGCCTGGGG + Intronic
1160715771 19:575937-575959 ACTGGGGGTGGGGGGGCGTCCGG - Intronic
1160724977 19:613867-613889 GCTCGCCGTGCGGCGGCCCCGGG - Exonic
1160960941 19:1720557-1720579 CCTCGGGCTGGGGCTGTCTCTGG - Intergenic
1160968148 19:1755531-1755553 GGTCGGGGTGTGAAGGCCTCCGG - Intronic
1162811652 19:13167760-13167782 GTTGGGGGTGGGGTGGTCTCAGG - Intergenic
1162909720 19:13842457-13842479 GGTCGGGGTGGAGGGGCCACTGG + Intergenic
1162931279 19:13959158-13959180 GAACGGGCTGGGGCCGCCTCAGG - Exonic
1163019658 19:14475404-14475426 GCGCGGGGTGGAGCGGCCCCTGG - Intergenic
1163471037 19:17497162-17497184 TCCCTGGGTGGGGCGGTCTCGGG + Intronic
1163508745 19:17723138-17723160 GCTAGGGGTGGGGCAGCATAAGG - Intronic
1163547409 19:17948320-17948342 GCGCGGGCGGCGGCGGCCTCGGG + Intergenic
1163655165 19:18541705-18541727 GCCGGGGCTGGGGCGGGCTCGGG + Exonic
1163797058 19:19343777-19343799 GCTGGGGGTGGCGCCTCCTCTGG + Intronic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1165355169 19:35299880-35299902 GGGCGGGGTGGGGCGGGGTCCGG + Intronic
1165803143 19:38565217-38565239 GCGCGGGTTGTGGCGGCCGCAGG + Exonic
1165939891 19:39409781-39409803 GCGCGGGGCGGGGCAGCCTGGGG + Intergenic
1166106793 19:40601595-40601617 GCTCCCGGCGGGGCGGCCCCGGG + Intronic
1166944101 19:46386570-46386592 GCTCAGGGTGGGGTGGGCTGGGG + Intronic
1166979422 19:46623950-46623972 GCACAGGGCGGGGCCGCCTCGGG + Exonic
1167248910 19:48390699-48390721 GGGCGGGCTGGGGAGGCCTCCGG - Intronic
1167464303 19:49642190-49642212 GCGCGGGGCGGGGCGGGCTGGGG - Exonic
1168277885 19:55287125-55287147 CCTGCGGGTGGGGGGGCCTCCGG + Intronic
925230978 2:2233513-2233535 GGGTGGGATGGGGCGGCCTCTGG + Intronic
925988014 2:9231567-9231589 GCTAGGGGTGTGGCGGCACCCGG - Intronic
926052595 2:9754294-9754316 ATTCGGGGCGGGGTGGCCTCGGG + Intergenic
927494845 2:23545496-23545518 CCTCGGGGTGGGGTGTCCCCAGG + Intronic
927809150 2:26172576-26172598 GCGCGGGTGGGCGCGGCCTCCGG + Intergenic
927982069 2:27380558-27380580 GGGCGGGGTCGGGCGGCCGCAGG - Exonic
928549502 2:32357252-32357274 GCTGCGGCTGCGGCGGCCTCGGG + Exonic
930534555 2:52630140-52630162 GCTGGGGGTGGGGCGGGGACAGG - Intergenic
930618952 2:53624732-53624754 GATGGCGGTGGGGTGGCCTCTGG - Intronic
931447881 2:62342033-62342055 GCTGGGAGTGGGGCAGCCTCAGG - Intergenic
933406918 2:81872251-81872273 CCTCTGGGTGGGGTGGCCACAGG - Intergenic
935205822 2:100895760-100895782 CCTAGGGGTGGGGCAGACTCAGG + Intronic
936062246 2:109302648-109302670 GCTCGGGATGGCGTGACCTCTGG + Intronic
936091956 2:109507247-109507269 GCCAGGGGTGGGGCCGGCTCGGG - Intergenic
940682661 2:156806055-156806077 GTTGGCGGTGGGGGGGCCTCAGG + Intergenic
941808691 2:169734375-169734397 CCCCGGGGCGGGGCGGTCTCCGG + Intronic
943060418 2:183037708-183037730 GCACGGGGTGGGGGCGCCGCTGG - Intronic
943185177 2:184598352-184598374 GCTCGGGCTGGCGCGGCCGCGGG + Exonic
946196165 2:218034019-218034041 GCTGGGGGCGGGCCGGCTTCTGG - Intergenic
946419061 2:219554711-219554733 GCTGAGGGTGCTGCGGCCTCTGG - Exonic
947593375 2:231396886-231396908 GGTTGGGGTGGGGGGGTCTCTGG + Intronic
947799547 2:232920205-232920227 GCTGGGGGTGAGGCTTCCTCTGG - Intronic
948036751 2:234863869-234863891 TCTGGGGGTGGGGCAGCCTAAGG + Intergenic
948046998 2:234952330-234952352 CCTGGGCGTGGGGCGGCTTCGGG + Intronic
948484257 2:238270645-238270667 GCTGGGGGTGTGCCTGCCTCTGG - Intronic
948645384 2:239400893-239400915 GCTCGGGCTCGGGCGGCGGCGGG + Exonic
948755890 2:240159403-240159425 GCATGGGGTGGGGCGGCAGCAGG - Intergenic
948806540 2:240455643-240455665 CCTGGGGGTGGGGAGGCCCCTGG + Intronic
1172523119 20:35582137-35582159 GCTCGAGGTGGAGCAGCCCCAGG - Intergenic
1174579919 20:51564126-51564148 GCTGGGGGTGGGGCTTTCTCAGG - Intergenic
1175280318 20:57799871-57799893 GCTCGGGTCTGGGCAGCCTCGGG + Intergenic
1175777093 20:61660205-61660227 AGACGGGGAGGGGCGGCCTCTGG - Intronic
1175939446 20:62531312-62531334 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1175939452 20:62531328-62531350 GCTCAGGGAGGGGCAGGCTCAGG - Intergenic
1176015149 20:62927062-62927084 GCTTGGGGTGGGGAGGCAGCAGG - Intronic
1176042321 20:63072200-63072222 CCTCCGGGTGGGCCGGGCTCGGG + Intergenic
1176089845 20:63313908-63313930 CCACGAGGTGGGGCAGCCTCAGG - Intronic
1176194249 20:63830408-63830430 GCTCGGGGCGCGGAGGGCTCGGG - Intronic
1176215974 20:63947940-63947962 GCCCTGGGAGGGGCAGCCTCTGG + Intronic
1176383570 21:6126015-6126037 GCTTAGAGTGGGGCCGCCTCAGG + Intergenic
1178351028 21:31873322-31873344 GCGCGGGGTGGGGCGCGGTCCGG - Exonic
1179726012 21:43341577-43341599 GCCCGGGGTGAGGGGGGCTCTGG + Intergenic
1179739900 21:43412223-43412245 GCTTAGAGTGGGGCCGCCTCAGG - Intergenic
1179810268 21:43865430-43865452 GCTGGGGCAGGGGCGACCTCCGG - Intronic
1179979544 21:44888990-44889012 GGTGGGGTTGGGGCGCCCTCAGG + Intronic
1180014769 21:45074819-45074841 GCTCGGGCGGGCGCGGGCTCCGG + Intronic
1180173915 21:46078362-46078384 GGCCGGTGTGGGGCAGCCTCAGG + Intergenic
1180741890 22:18059241-18059263 GCTGGGCGTGGGGTGGCTTCTGG - Intergenic
1181017697 22:20080548-20080570 GCGCGGGGTGGGGACGCCTCCGG + Intronic
1181309649 22:21937682-21937704 GCTCGGGCTGGGGGAGACTCCGG + Intronic
1182096677 22:27630548-27630570 GCTCGGGATGGGGGCGCCGCTGG + Intergenic
1182351054 22:29700204-29700226 GGTGGGGGTGGGGGGGCGTCGGG - Intergenic
1183409243 22:37645317-37645339 GCTCGGGGTGGGAAGGCCCTGGG + Intronic
1183731742 22:39622300-39622322 GCTGGGGGTCGGGAGGCCTCCGG + Intronic
1183984413 22:41561751-41561773 GCTCGGGGTGGGGTGGTACCTGG - Intronic
1184070626 22:42144228-42144250 GCTGGTGGTGGGGCATCCTCAGG + Intergenic
1184127821 22:42500423-42500445 CCTAGGGGTGGGGCCGCCTAGGG + Intergenic
1184153049 22:42649426-42649448 GCGCGGGGCGGGGCGGGCGCGGG + Intronic
1184175904 22:42788552-42788574 GGTCGGGGTGGGGTGGCTGCAGG + Intergenic
1184408188 22:44312020-44312042 CCTCGGGGTGGGGGTGGCTCTGG + Intronic
1184476065 22:44722066-44722088 GCTGGGGCGGGGGCTGCCTCGGG + Intronic
1184484332 22:44766904-44766926 GGTGGGGGTGGGGCTGCCGCAGG + Intronic
1184849295 22:47110833-47110855 CCTCGGTGTGGGAGGGCCTCTGG + Intronic
1185063116 22:48617293-48617315 CCCAGGGGTGTGGCGGCCTCTGG + Intronic
1185074839 22:48677638-48677660 GCTCAGGGGTGGGAGGCCTCGGG - Intronic
950452168 3:13071748-13071770 GTTCGGGGGATGGCGGCCTCTGG - Intronic
951543840 3:23806640-23806662 GCGCGGCGCGGGGGGGCCTCGGG + Intronic
951715808 3:25644691-25644713 ACACGGGGTGGGGGGGCATCAGG + Intronic
954431271 3:50472081-50472103 TCTTGGGGAGGGGCGGCCCCGGG + Intronic
955368780 3:58333113-58333135 GGGCGGCGTGGGGCGGCCCCGGG + Intronic
957588872 3:82169688-82169710 GCTGGGGCTGGGGAGGCCGCTGG + Intergenic
959539501 3:107523553-107523575 GCGCGGGCTGGAGCGGCCCCAGG + Intronic
959592068 3:108091597-108091619 GCCCTGGGCGTGGCGGCCTCGGG - Intergenic
960868570 3:122227312-122227334 GGTTGGGGTGGGGAGGGCTCAGG + Intronic
960954947 3:123025707-123025729 ACTCGGGGCAGGGCTGCCTCTGG - Intronic
960972558 3:123150235-123150257 TCTGGGGGCGGGGGGGCCTCAGG - Exonic
960995294 3:123336459-123336481 GCTCGGGGTGGACCAGCCACTGG - Intronic
961446354 3:126983373-126983395 GGTGGGCGCGGGGCGGCCTCCGG + Intergenic
962277917 3:134029833-134029855 GCGCGGGGTCGGGGCGCCTCGGG + Exonic
965347918 3:167575223-167575245 GCTCAGTGTGGGGCAGCCTGTGG - Intronic
966942467 3:184755681-184755703 GCTGGGTCTGGGGCGGGCTCTGG + Intergenic
968703372 4:2067037-2067059 GCTGGGGGTGGGGTGGCCCCAGG + Exonic
968878568 4:3286939-3286961 CCTCGGGCTGGGGAGGCCTCGGG + Intergenic
969409778 4:7020187-7020209 GCTCAGGGTGGGGAGGACTCTGG + Intronic
969471148 4:7389991-7390013 GCCTGGGGTGGGGCTGCCTGTGG + Intronic
973271795 4:48269716-48269738 GGGCGGGCTGGGGCGGCCCCGGG - Intronic
974385724 4:61200886-61200908 GCTCGGGGTTCGCCGGCCCCCGG + Intergenic
975701997 4:77075732-77075754 GCTCGAGCGGCGGCGGCCTCAGG - Exonic
977525695 4:98143154-98143176 GCTCGGGGTGGTGGGGGCGCTGG + Exonic
985064140 4:186104965-186104987 GCTCCGGGTGCGGGGACCTCAGG + Intronic
985550140 5:528661-528683 GCGCGGGGCGGGGCGGCGGCCGG - Intergenic
985625116 5:981824-981846 GCTCGGGGTGGGGCTGAAGCAGG - Intergenic
985625138 5:981898-981920 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625161 5:981972-981994 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625180 5:982046-982068 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985625220 5:982194-982216 GCTCGGGGTGGGGCTGAGGCAGG - Intergenic
985781962 5:1876332-1876354 GCTCGGGGTCCGGCGGCCGAGGG + Intergenic
986171487 5:5318185-5318207 GCTGGGGGCCGGCCGGCCTCAGG + Exonic
988931692 5:36041170-36041192 GCTTGGGGTGGGGTGGCCATGGG + Intronic
992515976 5:77492442-77492464 GCTTGGGGTGCGGCGGCCGACGG + Exonic
994518742 5:100802280-100802302 GCCAGGGATGGGGAGGCCTCAGG + Intergenic
995022376 5:107381038-107381060 GCTGGGGGTGGGGCGGGGTGGGG + Exonic
997292381 5:132747343-132747365 GCTCGCGGTGGAGCTACCTCTGG - Intergenic
997356407 5:133265728-133265750 GCTGGGGGAGGGGCAGCCTGTGG - Intronic
997386495 5:133476970-133476992 TCTGGGGGTGGGGCTGCATCTGG + Intronic
998033019 5:138889620-138889642 GGTGGGGGTGGGGGGGCCTTTGG - Intronic
998312862 5:141152271-141152293 GCTTGGGCCGGGGCCGCCTCAGG - Exonic
998322768 5:141247598-141247620 GCTTGGGCCGGGGCCGCCTCTGG - Exonic
999648928 5:153746656-153746678 GCTCTGGGGGTGGGGGCCTCTGG + Intronic
1001191772 5:169638042-169638064 GCTGGGGGAAGGGAGGCCTCAGG + Intronic
1002160587 5:177312025-177312047 ACTCGGGGCGGGGCGGCTGCCGG - Exonic
1002442835 5:179273234-179273256 GGGCGGCGGGGGGCGGCCTCTGG - Intronic
1002792882 6:448532-448554 TCGCGGGGTGGGGCTGCATCTGG - Intergenic
1002795954 6:471141-471163 GCTGGGGGTGGGGCAGCCTCTGG - Intergenic
1002892437 6:1347226-1347248 GCTAGGGGTGGGGGGGGCACTGG - Intergenic
1003590464 6:7432752-7432774 GCTGGGGGTGGGTCTGCCTTTGG - Intergenic
1003625213 6:7735129-7735151 GGTCAGGGTGGAGCGGGCTCCGG - Intronic
1005992884 6:30914349-30914371 GCGCGCGCCGGGGCGGCCTCCGG + Exonic
1006079725 6:31558328-31558350 GAGCGGGGAGGGGCAGCCTCTGG + Exonic
1006341066 6:33447328-33447350 GGTCGGGGTGGGGGGGACCCTGG + Intronic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1007282112 6:40720441-40720463 GGTGGGGGTGGGGAGGCCTGAGG - Intergenic
1007363212 6:41373190-41373212 GCGGGGGCTGGGGCGGACTCCGG - Intergenic
1007967368 6:46015395-46015417 GCTCGGGGTGCGCTGGACTCCGG - Intronic
1008536250 6:52508453-52508475 GCTCAGGGTGCGGCGGTCACTGG - Intronic
1013595986 6:111661687-111661709 GGGAGGGGTGGGGCAGCCTCTGG + Exonic
1018060903 6:160088948-160088970 GCCCGGGGAGTGGGGGCCTCGGG + Intronic
1018958390 6:168428676-168428698 CCTCGGGATGGGGAGGGCTCGGG + Intergenic
1019032319 6:169024172-169024194 GCCCGGGGAGGGGTGGCCGCCGG + Intergenic
1019342017 7:512822-512844 GCACGGAGCTGGGCGGCCTCAGG - Intronic
1019532210 7:1509434-1509456 GTGCGGGGTGGGGCGGCATCGGG - Intergenic
1019737627 7:2658549-2658571 GCTGGAGAAGGGGCGGCCTCCGG + Intronic
1019750995 7:2729658-2729680 GCTCGGGGCAGCACGGCCTCGGG + Exonic
1019923873 7:4179854-4179876 GCTGGGGGTGGGTCAGCCTGTGG + Intronic
1020099973 7:5389123-5389145 GCCCGGGGCGAGGAGGCCTCGGG - Exonic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022088159 7:27088475-27088497 GCTCGGGCAGCGGCGGCCGCGGG - Intergenic
1022157897 7:27678740-27678762 GGTGGGGGTGGGGTGGCATCTGG - Intergenic
1023220562 7:37916913-37916935 CCTGGGGGTGGGGCGGCCGAGGG - Exonic
1026201924 7:68221876-68221898 GATCGGGGGAGGGGGGCCTCTGG - Intergenic
1026850394 7:73719784-73719806 GTGCGGGGTGGGGCGGGGTCTGG - Intergenic
1029156435 7:98520920-98520942 GCTGGGGGTGGGCGGGGCTCTGG + Intergenic
1029156444 7:98520942-98520964 GCTGGGGGTGGGCAGGGCTCTGG + Intergenic
1032004021 7:128285672-128285694 GGTCGAGGTGGGGCGGTCTCAGG + Intergenic
1033361288 7:140640583-140640605 GCTCGGGGGCGGGCGGCGGCGGG + Exonic
1034483592 7:151341937-151341959 GCCAGGGGTGGAGCGGCCGCGGG + Intronic
1034618142 7:152436187-152436209 GCGCGGGGAGGGCCGGCCGCGGG + Intergenic
1037806279 8:22059418-22059440 GCTGGGAGTGTGGGGGCCTCTGG - Exonic
1038277067 8:26130266-26130288 CATTGGGGTGGGGCTGCCTCAGG + Intergenic
1045776766 8:105813108-105813130 GCAAGGGCTGGGGAGGCCTCAGG + Intergenic
1047430289 8:124785261-124785283 GCTCGGGGTGGGGAGCGCTGAGG - Intergenic
1047762077 8:127961826-127961848 ACTCGGGCAGGGGGGGCCTCTGG - Intergenic
1049229434 8:141474381-141474403 GGACTGGGTGGGGAGGCCTCTGG + Intergenic
1049426616 8:142540708-142540730 GTGCGGGGTGGGGCGGCCTTGGG + Intronic
1049465385 8:142749112-142749134 GCTCCGGGTGGTGGGGCCCCTGG + Intergenic
1049574186 8:143382891-143382913 CCTCAGGGTGGGGCAGCCCCAGG - Exonic
1049616610 8:143578333-143578355 GGTCGGGGCGGGGCGGAGTCCGG - Exonic
1049844075 8:144791726-144791748 GGTCGGGGTGGGGAGGGGTCTGG - Intronic
1057441024 9:95083309-95083331 GCTCTGTGTGGTGCGTCCTCTGG - Intronic
1057516824 9:95729159-95729181 GCTTGGGGCGGGGCGGGCCCCGG - Intergenic
1060269014 9:122128234-122128256 GCTGGGGGTGGGGGGGTCCCAGG - Intergenic
1060801767 9:126549547-126549569 GCGCGGGGTGGGGTGGGCTGGGG + Intergenic
1060849178 9:126860637-126860659 GCGCGGGCTGGGGCGGCAGCCGG + Intergenic
1061071560 9:128313959-128313981 GCTGGGGGTGGGGGGTCCTCAGG + Intronic
1061207386 9:129172918-129172940 GCCAGGGGTGGGGATGCCTCAGG - Intergenic
1061408598 9:130406112-130406134 GCGAGGGGTGGGGCTGCCCCGGG - Intronic
1061559837 9:131394780-131394802 GCGCGGGGTGGGCCGGGCCCCGG + Intronic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1061580167 9:131531354-131531376 GCTCCTGGTGTGCCGGCCTCGGG - Intergenic
1062265739 9:135685731-135685753 GCCGGGGGTGGGGTGGCCTGGGG + Intergenic
1062345115 9:136110945-136110967 GCTCTGGGGAGGGCGGCCCCTGG - Intergenic
1062349693 9:136132878-136132900 CCTGCGCGTGGGGCGGCCTCAGG - Intergenic
1062587440 9:137255605-137255627 GTTCCAGGTGGGGCGGCCCCCGG + Exonic
1189291514 X:39889224-39889246 GCTCGGGGAGGGGCTGCTTGTGG - Intergenic
1189323013 X:40097536-40097558 GGGCGGGGCGGGGCGGGCTCGGG + Intronic
1189487053 X:41442311-41442333 AGTCGGGGTGGGGCGGCCCCGGG - Intergenic
1200053463 X:153446539-153446561 CCTAGGGATGGGGCAGCCTCGGG + Intronic
1200097593 X:153671502-153671524 GCTGGGAGTGGGGTGGCCTGGGG - Intronic