ID: 1061581252

View in Genome Browser
Species Human (GRCh38)
Location 9:131538143-131538165
Sequence CACATTTTGCACTCTTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061581252_1061581260 9 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581260 9:131538175-131538197 GGGGTCTGTGCAAGGGCTACGGG No data
1061581252_1061581256 1 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581256 9:131538167-131538189 GCCGCTGAGGGGTCTGTGCAAGG No data
1061581252_1061581258 2 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581258 9:131538168-131538190 CCGCTGAGGGGTCTGTGCAAGGG No data
1061581252_1061581261 10 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581261 9:131538176-131538198 GGGTCTGTGCAAGGGCTACGGGG No data
1061581252_1061581255 -10 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581255 9:131538156-131538178 GCAAAATGTGAGCCGCTGAGGGG No data
1061581252_1061581259 8 Left 1061581252 9:131538143-131538165 CCAAGCAAAGAGTGCAAAATGTG No data
Right 1061581259 9:131538174-131538196 AGGGGTCTGTGCAAGGGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061581252 Original CRISPR CACATTTTGCACTCTTTGCT TGG (reversed) Intergenic
No off target data available for this crispr