ID: 1061584041

View in Genome Browser
Species Human (GRCh38)
Location 9:131554963-131554985
Sequence CGGGCGGCGTGGGCGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584041_1061584056 22 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584041_1061584059 29 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584041_1061584049 -1 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584041_1061584051 1 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584051 9:131554987-131555009 GCTCTTCTCGCCGCCCGCCGGGG No data
1061584041_1061584050 0 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584050 9:131554986-131555008 CGCTCTTCTCGCCGCCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584041 Original CRISPR CGGGCGGCGTGGGCGCGGCT GGG (reversed) Intergenic