ID: 1061584046

View in Genome Browser
Species Human (GRCh38)
Location 9:131554979-131555001
Sequence GGCGGCGAGAAGAGCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584046_1061584059 13 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584046_1061584066 25 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584066 9:131555027-131555049 GTGGTGAGTGGCCGCCGCCCTGG No data
1061584046_1061584056 6 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584046_1061584067 26 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584046 Original CRISPR GGCGGCGAGAAGAGCGCGGG CGG (reversed) Intergenic