ID: 1061584048

View in Genome Browser
Species Human (GRCh38)
Location 9:131554983-131555005
Sequence GGCGGGCGGCGAGAAGAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584048_1061584059 9 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584048_1061584056 2 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584048_1061584067 22 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584048_1061584066 21 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584066 9:131555027-131555049 GTGGTGAGTGGCCGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584048 Original CRISPR GGCGGGCGGCGAGAAGAGCG CGG (reversed) Intergenic