ID: 1061584049

View in Genome Browser
Species Human (GRCh38)
Location 9:131554985-131555007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584034_1061584049 20 Left 1061584034 9:131554942-131554964 CCCGCCGCCCGCCCAGCTCTACC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584041_1061584049 -1 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584036_1061584049 16 Left 1061584036 9:131554946-131554968 CCGCCCGCCCAGCTCTACCCAGC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584035_1061584049 19 Left 1061584035 9:131554943-131554965 CCGCCGCCCGCCCAGCTCTACCC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584040_1061584049 8 Left 1061584040 9:131554954-131554976 CCAGCTCTACCCAGCCGCGCCCA No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584042_1061584049 -2 Left 1061584042 9:131554964-131554986 CCAGCCGCGCCCACGCCGCCCGC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584039_1061584049 9 Left 1061584039 9:131554953-131554975 CCCAGCTCTACCCAGCCGCGCCC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584043_1061584049 -6 Left 1061584043 9:131554968-131554990 CCGCGCCCACGCCGCCCGCGCTC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584038_1061584049 12 Left 1061584038 9:131554950-131554972 CCGCCCAGCTCTACCCAGCCGCG No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data
1061584037_1061584049 13 Left 1061584037 9:131554949-131554971 CCCGCCCAGCTCTACCCAGCCGC No data
Right 1061584049 9:131554985-131555007 GCGCTCTTCTCGCCGCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584049 Original CRISPR GCGCTCTTCTCGCCGCCCGC CGG Intergenic