ID: 1061584053

View in Genome Browser
Species Human (GRCh38)
Location 9:131555000-131555022
Sequence AAGGGGAAGGCGGCCCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584053_1061584067 5 Left 1061584053 9:131555000-131555022 CCCGCCGGGGCCGCCTTCCCCTT No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584053_1061584059 -8 Left 1061584053 9:131555000-131555022 CCCGCCGGGGCCGCCTTCCCCTT No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584053_1061584066 4 Left 1061584053 9:131555000-131555022 CCCGCCGGGGCCGCCTTCCCCTT No data
Right 1061584066 9:131555027-131555049 GTGGTGAGTGGCCGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584053 Original CRISPR AAGGGGAAGGCGGCCCCGGC GGG (reversed) Intergenic