ID: 1061584054

View in Genome Browser
Species Human (GRCh38)
Location 9:131555001-131555023
Sequence GAAGGGGAAGGCGGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584054_1061584067 4 Left 1061584054 9:131555001-131555023 CCGCCGGGGCCGCCTTCCCCTTC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584054_1061584059 -9 Left 1061584054 9:131555001-131555023 CCGCCGGGGCCGCCTTCCCCTTC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584054_1061584066 3 Left 1061584054 9:131555001-131555023 CCGCCGGGGCCGCCTTCCCCTTC No data
Right 1061584066 9:131555027-131555049 GTGGTGAGTGGCCGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584054 Original CRISPR GAAGGGGAAGGCGGCCCCGG CGG (reversed) Intergenic