ID: 1061584056

View in Genome Browser
Species Human (GRCh38)
Location 9:131555008-131555030
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584047_1061584056 3 Left 1061584047 9:131554982-131555004 CCCGCGCTCTTCTCGCCGCCCGC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584042_1061584056 21 Left 1061584042 9:131554964-131554986 CCAGCCGCGCCCACGCCGCCCGC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584046_1061584056 6 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584044_1061584056 12 Left 1061584044 9:131554973-131554995 CCCACGCCGCCCGCGCTCTTCTC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584043_1061584056 17 Left 1061584043 9:131554968-131554990 CCGCGCCCACGCCGCCCGCGCTC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584041_1061584056 22 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584048_1061584056 2 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data
1061584045_1061584056 11 Left 1061584045 9:131554974-131554996 CCACGCCGCCCGCGCTCTTCTCG No data
Right 1061584056 9:131555008-131555030 GGCCGCCTTCCCCTTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584056 Original CRISPR GGCCGCCTTCCCCTTCCCCG TGG Intergenic