ID: 1061584059

View in Genome Browser
Species Human (GRCh38)
Location 9:131555015-131555037
Sequence TTCCCCTTCCCCGTGGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584041_1061584059 29 Left 1061584041 9:131554963-131554985 CCCAGCCGCGCCCACGCCGCCCG No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584044_1061584059 19 Left 1061584044 9:131554973-131554995 CCCACGCCGCCCGCGCTCTTCTC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584048_1061584059 9 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584047_1061584059 10 Left 1061584047 9:131554982-131555004 CCCGCGCTCTTCTCGCCGCCCGC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584052_1061584059 -5 Left 1061584052 9:131554997-131555019 CCGCCCGCCGGGGCCGCCTTCCC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584042_1061584059 28 Left 1061584042 9:131554964-131554986 CCAGCCGCGCCCACGCCGCCCGC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584054_1061584059 -9 Left 1061584054 9:131555001-131555023 CCGCCGGGGCCGCCTTCCCCTTC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584045_1061584059 18 Left 1061584045 9:131554974-131554996 CCACGCCGCCCGCGCTCTTCTCG No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584043_1061584059 24 Left 1061584043 9:131554968-131554990 CCGCGCCCACGCCGCCCGCGCTC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584053_1061584059 -8 Left 1061584053 9:131555000-131555022 CCCGCCGGGGCCGCCTTCCCCTT No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data
1061584046_1061584059 13 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584059 9:131555015-131555037 TTCCCCTTCCCCGTGGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584059 Original CRISPR TTCCCCTTCCCCGTGGTGAG TGG Intergenic