ID: 1061584067

View in Genome Browser
Species Human (GRCh38)
Location 9:131555028-131555050
Sequence TGGTGAGTGGCCGCCGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061584058_1061584067 -8 Left 1061584058 9:131555013-131555035 CCTTCCCCTTCCCCGTGGTGAGT No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584054_1061584067 4 Left 1061584054 9:131555001-131555023 CCGCCGGGGCCGCCTTCCCCTTC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584052_1061584067 8 Left 1061584052 9:131554997-131555019 CCGCCCGCCGGGGCCGCCTTCCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584048_1061584067 22 Left 1061584048 9:131554983-131555005 CCGCGCTCTTCTCGCCGCCCGCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584047_1061584067 23 Left 1061584047 9:131554982-131555004 CCCGCGCTCTTCTCGCCGCCCGC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584046_1061584067 26 Left 1061584046 9:131554979-131555001 CCGCCCGCGCTCTTCTCGCCGCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584055_1061584067 1 Left 1061584055 9:131555004-131555026 CCGGGGCCGCCTTCCCCTTCCCC No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584057_1061584067 -5 Left 1061584057 9:131555010-131555032 CCGCCTTCCCCTTCCCCGTGGTG No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data
1061584053_1061584067 5 Left 1061584053 9:131555000-131555022 CCCGCCGGGGCCGCCTTCCCCTT No data
Right 1061584067 9:131555028-131555050 TGGTGAGTGGCCGCCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061584067 Original CRISPR TGGTGAGTGGCCGCCGCCCT GGG Intergenic