ID: 1061586795

View in Genome Browser
Species Human (GRCh38)
Location 9:131574884-131574906
Sequence CAGTTTCCCCAGCTGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061586795_1061586800 8 Left 1061586795 9:131574884-131574906 CCCACTTCCAGCTGGGGAAACTG No data
Right 1061586800 9:131574915-131574937 AGAAGAAAACCACTTACCCAGGG No data
1061586795_1061586799 7 Left 1061586795 9:131574884-131574906 CCCACTTCCAGCTGGGGAAACTG No data
Right 1061586799 9:131574914-131574936 GAGAAGAAAACCACTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061586795 Original CRISPR CAGTTTCCCCAGCTGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr