ID: 1061586914

View in Genome Browser
Species Human (GRCh38)
Location 9:131575444-131575466
Sequence GCAGCTGCTGCGACCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061586914_1061586926 25 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586926 9:131575492-131575514 TGAGGCCTGAGGTCCATACCTGG No data
1061586914_1061586918 1 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586918 9:131575468-131575490 GCCCCGCAGCCCTGGTGGGAAGG No data
1061586914_1061586917 -3 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586917 9:131575464-131575486 TGCTGCCCCGCAGCCCTGGTGGG No data
1061586914_1061586922 7 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586922 9:131575474-131575496 CAGCCCTGGTGGGAAGGCTGAGG No data
1061586914_1061586916 -4 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586916 9:131575463-131575485 CTGCTGCCCCGCAGCCCTGGTGG No data
1061586914_1061586925 14 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586925 9:131575481-131575503 GGTGGGAAGGCTGAGGCCTGAGG No data
1061586914_1061586915 -7 Left 1061586914 9:131575444-131575466 CCAGGGTGGGTCGCAGCAGCTGC No data
Right 1061586915 9:131575460-131575482 CAGCTGCTGCCCCGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061586914 Original CRISPR GCAGCTGCTGCGACCCACCC TGG (reversed) Intergenic
No off target data available for this crispr