ID: 1061586930

View in Genome Browser
Species Human (GRCh38)
Location 9:131575514-131575536
Sequence GCACATCACCTCCTGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061586927_1061586930 -6 Left 1061586927 9:131575497-131575519 CCTGAGGTCCATACCTGGCACAT No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data
1061586921_1061586930 20 Left 1061586921 9:131575471-131575493 CCGCAGCCCTGGTGGGAAGGCTG No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data
1061586920_1061586930 21 Left 1061586920 9:131575470-131575492 CCCGCAGCCCTGGTGGGAAGGCT No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data
1061586924_1061586930 13 Left 1061586924 9:131575478-131575500 CCTGGTGGGAAGGCTGAGGCCTG No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data
1061586919_1061586930 22 Left 1061586919 9:131575469-131575491 CCCCGCAGCCCTGGTGGGAAGGC No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data
1061586923_1061586930 14 Left 1061586923 9:131575477-131575499 CCCTGGTGGGAAGGCTGAGGCCT No data
Right 1061586930 9:131575514-131575536 GCACATCACCTCCTGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061586930 Original CRISPR GCACATCACCTCCTGCTCAC TGG Intergenic
No off target data available for this crispr