ID: 1061587190

View in Genome Browser
Species Human (GRCh38)
Location 9:131576739-131576761
Sequence GTAGTTGCACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061587188_1061587190 5 Left 1061587188 9:131576711-131576733 CCAGCATGGAGCAGGCTGGGCTG 0: 1
1: 0
2: 5
3: 47
4: 336
Right 1061587190 9:131576739-131576761 GTAGTTGCACACATGCAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061587190 Original CRISPR GTAGTTGCACACATGCAGCT GGG Intergenic
904948580 1:34217318-34217340 TGATTGGCACACATGCAGCTAGG - Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
908764886 1:67545859-67545881 GTGGTTGGACACATGGATCTGGG - Intergenic
911244032 1:95497031-95497053 GTACTTGCAAAAATGGAGCTGGG + Intergenic
918094460 1:181323065-181323087 GTAGTTGCAAAAATGCAACTTGG + Intergenic
922703976 1:227779286-227779308 GCAGTGGGACACATGCAGCTTGG - Intronic
1067660455 10:48233267-48233289 GGGGTTTCACACATGCCGCTGGG + Intronic
1075934893 10:126331939-126331961 GTGGTTGCACCCTTGCAGCCAGG - Intronic
1078350984 11:10593307-10593329 GTAGTAGAATACATGCAGCCTGG + Intronic
1084479612 11:69411583-69411605 GTCTTTGCACACATGCAGAAGGG - Intergenic
1089233594 11:117003249-117003271 AGAGTTGGGCACATGCAGCTTGG - Intronic
1089639002 11:119834626-119834648 GTAGGTGCACACTTACACCTAGG + Intergenic
1090945936 11:131429660-131429682 CTATTTGAACACATCCAGCTGGG + Intronic
1099773584 12:87096430-87096452 GCATTTGCACACATGCTGTTTGG + Intergenic
1104288227 12:127444863-127444885 ACAGGTGCACACCTGCAGCTAGG + Intergenic
1105809309 13:23980261-23980283 GTAGTTGCACAAAGCCAGCCTGG + Intronic
1107268362 13:38584283-38584305 GGATTTGCACACTGGCAGCTTGG + Intergenic
1120439679 14:84520580-84520602 GTAGTAGCACAAAGGTAGCTAGG - Intergenic
1120836036 14:89039219-89039241 GTGGTGGCATACATACAGCTAGG - Intergenic
1122974449 14:105165342-105165364 GTGCGTGCACACACGCAGCTGGG + Intronic
1125767640 15:42146017-42146039 GTGGTTGCACACAGGCACCTTGG - Intronic
1126012629 15:44317679-44317701 GCAGTTGGACATATGGAGCTCGG - Intronic
1128684108 15:69671098-69671120 GTTGCTGCAGACATGCTGCTAGG + Intergenic
1129672367 15:77614356-77614378 GTAGCTGCGCACATGCAGGTGGG + Exonic
1139272474 16:65697226-65697248 TGAGTTGCACAGATTCAGCTGGG - Intergenic
1153159361 18:2185705-2185727 GTAGTTGCCAACATGCAATTTGG - Intergenic
1157114758 18:44852379-44852401 ATTGCTGCAAACATGCAGCTTGG + Intronic
1159823033 18:73170969-73170991 CTGGGTGCACCCATGCAGCTTGG - Intronic
1161031272 19:2058773-2058795 CTTGTTGCACACATCCAGCCGGG - Intergenic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG + Intronic
948617401 2:239209424-239209446 GGTGTTCCACAAATGCAGCTGGG + Intronic
1170910347 20:20560228-20560250 CTAGTTGAACACGTGCAGCATGG - Intronic
1175876451 20:62232460-62232482 GCAGTTGCACACAGCCGGCTGGG - Intronic
1177381567 21:20351583-20351605 GTGGTTCCACACATACAGCAGGG - Intergenic
1180137414 21:45870763-45870785 CTAGCTGGACACACGCAGCTGGG - Intronic
1180945324 22:19689279-19689301 GTGGTTGCACAGTTGCAGGTGGG + Intergenic
1183862669 22:40681072-40681094 GTTGTTGCACCAGTGCAGCTTGG - Exonic
953290856 3:41660615-41660637 CAAGTTGCACACATGTTGCTAGG + Intronic
959649495 3:108737848-108737870 GAAGTTGTACACATGCCCCTTGG - Intergenic
960816799 3:121682022-121682044 GTAGTGAAATACATGCAGCTAGG + Intronic
961706147 3:128787189-128787211 GTTGTTGCAGACAGGCAACTTGG + Intronic
965272633 3:166638449-166638471 CTAGGTTCACAGATGCAGCTTGG - Intergenic
965686584 3:171309773-171309795 GTGGTGTCACACAAGCAGCTGGG + Intronic
968280047 3:197469661-197469683 ATGGGTGCAAACATGCAGCTAGG + Intergenic
975939917 4:79630259-79630281 GTATTTGCAAACATGCAATTAGG + Intergenic
976615826 4:87075646-87075668 GTAGTTGCCTAAATGCAGTTTGG - Intronic
977467920 4:97404547-97404569 AGTGTTTCACACATGCAGCTAGG - Intronic
978533945 4:109741263-109741285 AGAGTTGCAGAGATGCAGCTTGG + Intronic
978643815 4:110904709-110904731 GTAGTTGCTCACTTACAGCCTGG + Intergenic
984875138 4:184360913-184360935 GTAGTGGCAGAAATGCTGCTTGG - Intergenic
988836421 5:35037033-35037055 GCAGTGGCACAAAAGCAGCTCGG - Exonic
990352721 5:54934917-54934939 GTAGTTGCTAACATGAAGGTGGG + Intergenic
995553468 5:113303164-113303186 GCAGTTGCATATATGCATCTTGG + Intronic
1001677216 5:173528601-173528623 GGATGTGCACACATCCAGCTAGG - Intergenic
1013362226 6:109404608-109404630 GTAGGTGCTCACATGGTGCTAGG - Intronic
1034952997 7:155313577-155313599 TTAGTTGCAAACACCCAGCTAGG + Intergenic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039044373 8:33436446-33436468 GATGTTGCCCACATGCAACTTGG + Intronic
1041943145 8:63410391-63410413 GTAGTTGCCAACCTGCAGCCTGG - Intergenic
1044436341 8:92168238-92168260 GAAATTGTACACATGCATCTAGG - Intergenic
1050028890 9:1364591-1364613 CCAGATGCACACATGCACCTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054866574 9:70008811-70008833 GTAATAGCACACACACAGCTGGG + Intergenic
1056190796 9:84182104-84182126 GTAGTAACACACACGCAGCAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057118724 9:92550931-92550953 GTAGCTGCTCATATGGAGCTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058624117 9:106916413-106916435 GAAGTTGCAGATATGCTGCTGGG - Intronic
1058933483 9:109745809-109745831 CTAGTTGTAACCATGCAGCTTGG + Intronic
1059852762 9:118362791-118362813 GAAGTTGCACACAGGCAATTGGG + Intergenic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1061587190 9:131576739-131576761 GTAGTTGCACACATGCAGCTGGG + Intergenic
1185870873 X:3663865-3663887 GTGGGCGCACACATGTAGCTTGG + Intronic
1188220657 X:27537694-27537716 GTATTTCCACACATGCATCTGGG + Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1199507430 X:148580114-148580136 CTAGTTCCACAGATGCACCTTGG - Intronic
1199698216 X:150358674-150358696 GTACTTTCACACATGCACCTGGG - Intergenic
1200793210 Y:7317646-7317668 GTGGGCGCACACATGTAGCTTGG - Intergenic