ID: 1061589231

View in Genome Browser
Species Human (GRCh38)
Location 9:131588122-131588144
Sequence CTCTCTGCCCAGCAGGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061589226_1061589231 7 Left 1061589226 9:131588092-131588114 CCCGGGCTGCGGGCGTCAGAGCA 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 332
1061589221_1061589231 29 Left 1061589221 9:131588070-131588092 CCGGTGGGGAGGGCTGAGCAGGC 0: 1
1: 0
2: 5
3: 55
4: 429
Right 1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 332
1061589227_1061589231 6 Left 1061589227 9:131588093-131588115 CCGGGCTGCGGGCGTCAGAGCAG 0: 1
1: 0
2: 0
3: 20
4: 172
Right 1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG 0: 1
1: 0
2: 1
3: 16
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061589231 Original CRISPR CTCTCTGCCCAGCAGGAGCG TGG Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
900551294 1:3257267-3257289 CTCTCTGCCTTCCAGGAACGAGG + Intronic
900554793 1:3275031-3275053 CCCCCAGCCCAGCAGGAGCACGG + Intronic
900637142 1:3671531-3671553 TTGTCTGCCCTGCAGGAGCCGGG + Intronic
900646014 1:3709038-3709060 CCCTCGGCCCTCCAGGAGCGTGG - Intronic
901636614 1:10673501-10673523 CCCCCTCCCCAGCAGGAGAGAGG - Intronic
901859258 1:12063757-12063779 TTCCCTGCCCAGCTGGAGTGAGG + Intronic
902257550 1:15199808-15199830 ACCTCTGCCCAGCAGCAGCTAGG - Intronic
902283546 1:15391584-15391606 CTTTCTGCAAAGCAGGAGTGTGG - Intronic
902410745 1:16210198-16210220 CTCTCTGCCCAGCTGGCTGGGGG + Intronic
902561037 1:17277698-17277720 CTCTGCCCCCAGCAGGAGCCTGG + Intronic
902877384 1:19349152-19349174 CTGTCTGCTCAACAGGAGCTGGG + Intronic
903054584 1:20626722-20626744 CTTCCTTCCCAGCAGGAGTGAGG - Intergenic
903264694 1:22150803-22150825 CTCCCTGCCCAGCAGAAGGCAGG + Intergenic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
904696599 1:32335090-32335112 CCCTCTGCCCTGCAGGAGAATGG - Exonic
904850383 1:33454862-33454884 TGCTCTGCCCAGCAGCAGAGTGG + Intergenic
905010612 1:34744649-34744671 CCCTCTCTCCAGCAGGTGCGGGG + Intronic
905087090 1:35390430-35390452 TTCTCTGGCGAGCAGGAGTGGGG + Intronic
907250266 1:53133463-53133485 CTCACTGCTCAGCAGCAGGGAGG + Intronic
911064460 1:93775409-93775431 CTACCTGCCCAGCACGCGCGCGG + Intronic
912747731 1:112259384-112259406 CTCTCTCTCCAGAAGGAGCCAGG - Intergenic
914882677 1:151559752-151559774 CTCTCTGCCACACAGGAGGGTGG - Intronic
915634548 1:157177094-157177116 CTCTCTGTCCTGCAGGAGCAGGG + Intergenic
915874742 1:159600654-159600676 CTCTATGCCCAACAAGAGTGAGG + Intergenic
917734366 1:177907124-177907146 ATCTCAGCCCTGCAGGAGCACGG + Intergenic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
920310331 1:205044548-205044570 CCCTCTGCTCAGAAGGAGCTGGG + Intronic
920691993 1:208154189-208154211 CACTCTGCCCAGCAGCTGTGGGG - Intronic
922513295 1:226186988-226187010 GTCAGTGCCCAGCAGGGGCGGGG + Intergenic
922753323 1:228081347-228081369 CTCCCTGCTCAGCCAGAGCGGGG - Intergenic
922798713 1:228354088-228354110 ACCTCTGCCCAGCAGGGGAGGGG - Intronic
923089931 1:230732387-230732409 CTCTGTGCCCACCAAGAGCAGGG + Intergenic
923676120 1:236082020-236082042 CTCACTGCCCTGCAGGCGAGGGG + Intergenic
924849225 1:247808207-247808229 CTCACTGCCCAGCTGCAGTGAGG + Intergenic
1062960882 10:1573036-1573058 CTCGCTGGCCTGCAGGAGCCTGG - Intronic
1064097619 10:12435584-12435606 CTCTGTGCCCAGCAGGTTGGAGG + Intronic
1064296940 10:14087603-14087625 CTCTCATCCCACCAGGAGCCAGG - Intronic
1065044410 10:21733818-21733840 GACTCTGCCCAGCAGGAGGTGGG - Exonic
1066782460 10:38967576-38967598 TTCTCTCCACAGCAGGAGGGAGG + Intergenic
1067062055 10:43082623-43082645 CTCCATGCCCTGCAGGAGCCAGG + Intronic
1067682639 10:48450451-48450473 CCCGCTCCCCAGCAGCAGCGAGG - Exonic
1067829211 10:49600403-49600425 CTCTCACCCCTGCAGGAGCCAGG - Intergenic
1069708916 10:70476846-70476868 CTCCCTGCCCAGCAGATGCTGGG - Intergenic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1070559248 10:77553493-77553515 GTGACTGCCCAGCAGGAGGGAGG - Intronic
1070789015 10:79178728-79178750 CTGTCAGCCCAGCCGGAGAGAGG + Intronic
1070806131 10:79271810-79271832 CCCTCTGCCCAGCAGGCTCCAGG - Intronic
1073132808 10:101201179-101201201 CTCTCTGGCGGGCAGGAGTGGGG + Intergenic
1073323707 10:102630512-102630534 CGCACAGCCCAGCAGGAGGGAGG + Exonic
1075481968 10:122789734-122789756 CTCTGTCCCCAGCAGGGGCCTGG + Intergenic
1075724593 10:124604893-124604915 CTCTCTACCCTGCAGGGGCAGGG - Intronic
1075958588 10:126546631-126546653 CTCACTGCCCAGCAGCAATGAGG + Intronic
1076284299 10:129277952-129277974 CTTTCTGCCCAGCAGGTGGTGGG + Intergenic
1076692410 10:132230605-132230627 CCCTCTGCCCCTCAGGAGCCTGG + Intronic
1076749811 10:132537158-132537180 CTCTCCGCGCAGACGGAGCGTGG - Intergenic
1077028757 11:453789-453811 CTCCCTGCCCACCATGAGAGTGG + Intronic
1077800269 11:5529682-5529704 GTCTCTGCCCTGCAGGAGTCAGG - Intronic
1080810800 11:35702288-35702310 CTCGCTGCCCTCCCGGAGCGTGG - Intronic
1080861784 11:36156361-36156383 AGCTCTGCCCAGCAGGACCCTGG + Intronic
1083170719 11:60922668-60922690 CTCATTGCCCAGCAGTAGGGAGG + Exonic
1084353693 11:68623006-68623028 TTCTCTGGCGAGCAGGAGTGGGG - Intergenic
1084356454 11:68641870-68641892 TGCTCTGCCCAGCAGCTGCGAGG + Intergenic
1084400883 11:68942296-68942318 CTCCCTGGCCAGCTGGAGTGTGG + Intergenic
1084665935 11:70576301-70576323 CTCTCTCCCCAGGAGGTGCATGG - Intronic
1085250755 11:75142121-75142143 CTCTCTGCTGAGCCGGAGCTGGG + Intronic
1085310070 11:75510851-75510873 CTCTCTGCCCCTCAGGACCTGGG + Intronic
1088013068 11:105026606-105026628 GTCTCTGCAGGGCAGGAGCGGGG + Intronic
1088129862 11:106474606-106474628 CTCTATGCCTATCAGGAGCCAGG + Intergenic
1089253639 11:117182045-117182067 TTCTCTGCCCTGCAGGACTGGGG + Exonic
1089255259 11:117190608-117190630 CTCTCTCCCCAACAGGAATGTGG + Exonic
1091890629 12:4051406-4051428 CTCACTTCCCAGCATGAGGGTGG - Intergenic
1095966425 12:47870242-47870264 CTCTCTGCCCACGAGGAGTCAGG + Intronic
1096617919 12:52844716-52844738 CTGTCTTCCCTGCAGGAGCTGGG - Exonic
1096999090 12:55861293-55861315 CTGTCTGCCAAGCTGGAGTGCGG + Intergenic
1098014314 12:66088339-66088361 CTTTCTGCCCTGCAGAAGCCAGG + Intergenic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1101029537 12:100645758-100645780 GTCTCTTCCCAGCAGGGGCAAGG + Intergenic
1101585807 12:106084487-106084509 CTCTCTGCTCAGCAGGACTCAGG + Intronic
1101889874 12:108703738-108703760 CCCTCTCCCCAGCAGAAGCCAGG + Intronic
1102780898 12:115563541-115563563 CCCTCTGCCCAGCTGGAGACTGG + Intergenic
1102855993 12:116294251-116294273 CTCTGTGGCCAGCAGGAGCTTGG + Intergenic
1103209872 12:119158060-119158082 CTCTCTGCCCAGCCCCAGCCAGG - Exonic
1103565352 12:121812530-121812552 CCCTCTGCCCAGCAGTCTCGGGG - Intronic
1107024727 13:35788275-35788297 CTCTCTGCTCAGCTGGACCACGG - Exonic
1110701576 13:78554795-78554817 CTCTCTGCTCAGCAGTACAGGGG + Intergenic
1113411893 13:110097388-110097410 CTCTTTGGCCAGTAGGAGCACGG - Intergenic
1113782060 13:112982492-112982514 CCCTCTGCCCATCAGGTGGGAGG + Intronic
1117245014 14:53876012-53876034 CTCCATGCCCAGCAGAAGAGAGG - Intergenic
1117377492 14:55129440-55129462 TGCTCTGCCCTCCAGGAGCGGGG + Intronic
1117844916 14:59900819-59900841 CTTTCTGCCCAGCAGGATATTGG - Intergenic
1119334466 14:73820890-73820912 CTCTCAGCTGAGCAGGAGCCCGG - Intergenic
1119473615 14:74914136-74914158 CCCTTTTCTCAGCAGGAGCGAGG + Intronic
1119759200 14:77139630-77139652 CTTCCTGCCCAGCATGCGCGAGG - Exonic
1119905392 14:78297607-78297629 CTTTCTGCCCAGCAGCAGGAAGG + Intronic
1121599277 14:95191122-95191144 CTCTCTCCCCAGCTGGGGCTTGG + Exonic
1121895056 14:97639222-97639244 CCCACTGCACAGCAGGAGCCTGG - Intergenic
1122027165 14:98886453-98886475 CTCTCTGCCCTCCTGGAGCTTGG + Intergenic
1122705295 14:103617088-103617110 CTTTCTTCCCTGCAGGAGCCTGG + Intronic
1122825260 14:104367598-104367620 CGCTCTGGCCAGCAGGACTGGGG - Intergenic
1122880686 14:104689379-104689401 ATCTCCGCCCACCAGGAGCCAGG + Intergenic
1122961177 14:105094183-105094205 CTCCCTGCCCTCCAGGAGCTTGG + Intergenic
1123034488 14:105466373-105466395 GCCTCTGCCCAGCAGGGGAGGGG - Intronic
1202906011 14_GL000194v1_random:72880-72902 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1125843610 15:42829998-42830020 CTGTCTACCCAGCCGGAGAGTGG + Exonic
1126256786 15:46636637-46636659 CTCCCTGCCCAGCAGAAGTCTGG - Intergenic
1128306891 15:66604576-66604598 GTCTCTGCCCTGCAGGAGAGAGG - Intronic
1130876075 15:88015650-88015672 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
1130971762 15:88739354-88739376 CTGTCTGCCCAGATGGACCGAGG - Intergenic
1131261307 15:90889455-90889477 CCCTGGGCCCAGCAGGAGCAAGG - Intronic
1134057263 16:11178411-11178433 CTCTAAGCCCAGCAAGAACGTGG + Exonic
1134516817 16:14894290-14894312 CTGTCTGCCCAGCAAAAGGGAGG + Intronic
1135432395 16:22396665-22396687 CAGTCTGCCCAGGAGGAGCCTGG + Intronic
1135673599 16:24395329-24395351 GGCTCTCCCCAGCAGGAGCTGGG - Intergenic
1136228356 16:28873356-28873378 CACTCAGCCCCCCAGGAGCGTGG - Intronic
1137707315 16:50544586-50544608 CTCTCTGCCCAGCCTCAGCCAGG - Intergenic
1137707445 16:50545355-50545377 CTCCCAGCCCAGCAGGCGCCTGG - Intergenic
1138403922 16:56772920-56772942 CTCTCTTCCCAGCAGGCTGGAGG - Intronic
1141252069 16:82368198-82368220 CTCACAGCCCAGCTGGAGCTGGG - Intergenic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141461346 16:84180252-84180274 CAGTCGGGCCAGCAGGAGCGGGG + Exonic
1142034991 16:87857128-87857150 CTCTCTGGCCAGCAGTGGCAGGG - Intronic
1142322326 16:89391469-89391491 CTTTCTGCCCAGCAGCAGGGAGG - Intronic
1143767354 17:9146424-9146446 GTCTGTGCCCAGAAGGAGTGAGG - Intronic
1143904415 17:10198041-10198063 GTCGCTGCCCCCCAGGAGCGTGG + Intronic
1145061919 17:19738996-19739018 CTCTCTGCCCTTCGGGGGCGTGG - Exonic
1145998293 17:29116966-29116988 ATCCCTGCCCAGGAGGAGCCAGG - Intronic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1151704266 17:75758409-75758431 GCCTGTGCCCGGCAGGAGCGGGG + Intronic
1151732774 17:75921046-75921068 AGCTCTGCCCAGGAGCAGCGAGG + Intronic
1151954426 17:77373382-77373404 AGCTCTGCACTGCAGGAGCGCGG + Intronic
1151975197 17:77480529-77480551 CACTCTGCCCAGAAGGTGGGAGG - Intronic
1152264983 17:79288915-79288937 CTCTGTCCCCAACAGGAGCCAGG - Intronic
1152318142 17:79592886-79592908 CTCCCTGCCCAGAAGGAACCTGG + Intergenic
1152845517 17:82597346-82597368 TTCTCTGCCCTGGAGGAGAGGGG + Intronic
1153104521 18:1511389-1511411 CTCCCCGCCCAGCAGCAGCAGGG - Intergenic
1154010273 18:10568293-10568315 CTCTCAGCCTTGCAGGAGGGAGG + Intergenic
1154200401 18:12296010-12296032 CTCTCTACCCAGCACGAGAGAGG + Intergenic
1155943959 18:31826850-31826872 CTCTCTGGCAGGCAGGAGCAGGG + Intergenic
1156014566 18:32533376-32533398 CTCTCTGGCGGGCAGGGGCGGGG + Intergenic
1156150338 18:34234063-34234085 CTCACTGCCCAGGACCAGCGGGG - Intergenic
1156355900 18:36339636-36339658 CTCTTTGCCCAGCAGGGGCCTGG + Intronic
1157528444 18:48403000-48403022 CACTCAGCCCTGCAGGAGCAGGG - Intronic
1157863099 18:51159329-51159351 GTCTCTGTCCATCAGGAACGTGG - Intergenic
1158597875 18:58832261-58832283 CCATCTGCCCAGCAGGAAAGGGG + Intergenic
1158636734 18:59165570-59165592 CTCCCTGGCCATCAGGAGCAAGG + Intergenic
1160591603 18:79947877-79947899 CCCTCTGCACAGCAGGACCTGGG + Intronic
1160927889 19:1555811-1555833 CTCGCTGCCCAGCAGCCCCGCGG - Exonic
1161265570 19:3362074-3362096 CTCTCGGCCCTGCAGAAACGCGG - Intronic
1161390120 19:4016331-4016353 CACTCTGCACAGCAGGCGGGTGG - Intronic
1162059346 19:8085498-8085520 GTCTCTGTCCAGCAGCAGTGAGG - Exonic
1162895975 19:13764856-13764878 ATCCCTGCCCCGCAGGTGCGGGG + Exonic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166770711 19:45280455-45280477 CTTCCTGCCCAGCAGGAGGTAGG - Exonic
1167147817 19:47693712-47693734 CCCGCTGCCCAGCAGGAGGCAGG - Intronic
1167765246 19:51478477-51478499 CACTCTGACCAGCAGGGGTGGGG - Intergenic
925041549 2:735141-735163 CTCTCTGCCCAGCTGGGCCCAGG + Intergenic
925810623 2:7696753-7696775 CTCTCTGGCTGGCAGGGGCGGGG + Intergenic
925897347 2:8482863-8482885 CTCTCTTCACAGCAGAAGTGGGG - Intergenic
927105710 2:19821961-19821983 CTCTCTGCTCAGCATGTGGGTGG + Intergenic
928770903 2:34701136-34701158 TTCTCTGCCAGGCAGGAGTGGGG + Intergenic
928988514 2:37205435-37205457 TTCTCTGCCTGGCAGGAGTGGGG - Intronic
934500588 2:94857637-94857659 CTCTCTTCCGAGGAGGAGCGGGG - Intergenic
934563532 2:95325332-95325354 AGCTCAGCCCAGCAGGAGGGCGG + Intronic
935244189 2:101204073-101204095 TTCTCTGCACAGCAGGGGAGGGG + Intronic
935734406 2:106095634-106095656 CCCTGTGTCCAGCAGGAGCCCGG - Intronic
936056792 2:109267839-109267861 ACCTCTGTCCAGCAGGAGCCTGG - Intronic
936056946 2:109268501-109268523 ACCTCTGTCCAGCAGGAGCCTGG + Intronic
937040975 2:118820386-118820408 CTCTCTGCCCACCAGTGGCAGGG - Intergenic
937200947 2:120204228-120204250 CCCTCTGACCAGCAGGAGCCTGG - Intergenic
938127093 2:128682447-128682469 CTCTCTGCACAGCAAGACCCTGG - Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
940918897 2:159286574-159286596 CGCTCTCACCTGCAGGAGCGGGG + Exonic
942046630 2:172102772-172102794 CTCCTTGCCCAGCGCGAGCGCGG + Exonic
944394608 2:199252484-199252506 TTCTCTGGCCGGCAGGAGTGGGG - Intergenic
945055892 2:205868755-205868777 CTCTCTTCCAGGCAGGAGTGAGG + Intergenic
945482924 2:210363785-210363807 ATCTCTGCATAGCAGGAACGGGG + Intergenic
946690453 2:222305289-222305311 CTCCCTGCCCAGCAGCAGCTGGG - Intergenic
946904383 2:224401990-224402012 CTCTCCACACAGCAGCAGCGGGG + Exonic
947941535 2:234060399-234060421 GTATCTGCCCAGCAGGTGCAGGG + Exonic
948150420 2:235740146-235740168 CCCGCTGCCCAGCAGGAGCAGGG + Intronic
948931434 2:241134884-241134906 GCCTCTGCCCACCTGGAGCGTGG - Intronic
948945158 2:241215622-241215644 CTCTGTGCCTGGCAGGAGCAGGG + Intronic
1169268272 20:4180871-4180893 CTGTCTCCCCAGCTGGAGTGAGG + Intronic
1170852568 20:20017851-20017873 CCCTCTGCCCAGAAGAGGCGCGG - Intronic
1171891813 20:30724339-30724361 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1172121581 20:32602025-32602047 CTGACTGGCCTGCAGGAGCGTGG + Intronic
1172669373 20:36624192-36624214 CTCTCTTCTCAGCAGGAAGGAGG + Intronic
1172854974 20:37994686-37994708 CTCCCTGCCCATCAGGAGGGAGG + Intronic
1173293745 20:41737394-41737416 CTCTCTGCCCTGCATGACAGGGG - Intergenic
1173595602 20:44257083-44257105 CACTCTGCCCAGGTGGGGCGGGG - Intronic
1173861426 20:46286293-46286315 CTCCCTGCCCAGCATCAGAGTGG - Intronic
1173949443 20:46978735-46978757 CTCTCTGCCCAGGAAGACCACGG - Intronic
1174041286 20:47701596-47701618 CTCTATGCTCACCAGGAGCTAGG + Intronic
1175087018 20:56468391-56468413 CTCGCTGCCCTCCCGGAGCGTGG + Intergenic
1175173782 20:57097468-57097490 CTCTCTGTCAAGCAGGACAGGGG + Intergenic
1175902690 20:62366367-62366389 ATCTCTGCCCAGCAGGTGGTAGG - Intronic
1176231523 20:64035679-64035701 CCCTCAGCCCAGGAGGAGTGAGG + Intronic
1176625366 21:9087636-9087658 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1179122648 21:38562782-38562804 CTCTCGGTCCTGCAGGAGCTGGG - Intronic
1182118518 22:27772209-27772231 CCCTCAGCCCAGCAGGGGCTGGG + Intronic
1182472315 22:30556086-30556108 CTCTGTCCCCAGCAGGACCCCGG - Exonic
1183257377 22:36771169-36771191 CTCTCAGCCCAGAAGCAGGGAGG - Intronic
1183653725 22:39173396-39173418 CTCTCTGACCACCTGGAGCCAGG + Intergenic
1183723619 22:39576519-39576541 CTCTCTGCCCTGGTGGAGTGTGG - Intronic
1183966751 22:41446874-41446896 CCCTCCGCCCTGCAGGGGCGGGG + Exonic
1184276331 22:43411582-43411604 CTCCCTGCCCAGCCCGCGCGCGG + Intronic
1184286279 22:43473513-43473535 CTCTCGGCCCAGGAGGGGCCAGG + Intronic
1184522506 22:45003493-45003515 GTAGCTGCCCCGCAGGAGCGAGG + Intronic
1184631208 22:45781358-45781380 AGCTCTGCCCAGCAGTAGTGAGG + Intronic
1184902764 22:47457839-47457861 CTCTCTCCCCAGCTGGACTGTGG - Intergenic
1185219459 22:49622218-49622240 CTCTCAGCCCTGCAGGACCATGG - Intronic
1185374420 22:50475379-50475401 CTCTCTGTCCAGCGGGAGAAAGG + Intergenic
949959775 3:9302421-9302443 CGCTCTGCCCAGCTGCAGCCAGG + Intronic
950386354 3:12663689-12663711 CCCTCTGCCCGGCAGCCGCGGGG + Intronic
950463361 3:13138717-13138739 CTGCCTGCCCAGCAGAAACGGGG - Intergenic
950476075 3:13215707-13215729 CTCTCTGCCCAGCCCGTGCCAGG - Intergenic
950888740 3:16384292-16384314 CTCTCTTCCCACCAGGAGGTAGG + Intronic
953169971 3:40498071-40498093 CTCTCTGCCAAGCAGCACCCAGG - Intergenic
953176164 3:40554504-40554526 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
954613821 3:51959569-51959591 CTCTCTGCCAACCAGGTGAGGGG - Exonic
954789798 3:53123798-53123820 CTCTCTGGCCAGGAAGAGGGTGG + Exonic
954796329 3:53162993-53163015 CTCACTCCACAGCAGGAACGAGG - Intronic
954925617 3:54231825-54231847 CTCACTGTCCAGCAGGTGCATGG + Intronic
955476349 3:59340332-59340354 ATCTGTAGCCAGCAGGAGCGAGG + Intergenic
956864001 3:73351610-73351632 CTCTCTTACCAGCCGGAGTGGGG + Intergenic
958919025 3:100082362-100082384 CTCTCTCCCCAGCAGTACAGAGG - Intronic
961318169 3:126054803-126054825 CTCTCTCCCCAGCATCAGCAGGG + Intronic
962121522 3:132565422-132565444 CTCTCTGCCTAGCAGTAATGAGG + Intronic
962468079 3:135678975-135678997 CTCTCTGCTCAGTAGGTGTGAGG + Intergenic
962609911 3:137066444-137066466 CTCTCTGCCCAGCATGGGCTTGG + Intergenic
962739819 3:138355233-138355255 CTCTCTGCCAAGCAGGAGTAAGG + Intronic
963320628 3:143805727-143805749 TTCTCTGGCAGGCAGGAGCGGGG - Intronic
964984106 3:162718070-162718092 TTCTCTGGCCGGCAGGAGTGGGG - Intergenic
966104632 3:176321797-176321819 TTCTCTGGCGAGCAGGAGTGGGG + Intergenic
966105419 3:176327091-176327113 TTCTCTGGCGAGCAGGAGTGGGG + Intergenic
968353374 3:198080888-198080910 CTCTCTTCGGAGGAGGAGCGGGG - Intergenic
968487241 4:868575-868597 CTCACCGCCAAGCAGCAGCGCGG - Exonic
968601558 4:1512270-1512292 CTGGCTGCCCTGCAGGGGCGTGG - Intergenic
968619112 4:1595720-1595742 CTCTCTGCCCGGCTGGACTGGGG - Intergenic
968654416 4:1772399-1772421 CTCTATGCCATGCAGAAGCGTGG + Intergenic
968905040 4:3447081-3447103 CTCTGTGCCCAGCAGGAGTGAGG + Intronic
969180316 4:5435736-5435758 CTCTCTGCCCTCAAGGAGCTTGG + Intronic
972573759 4:40333424-40333446 TCCTCTGCCCAGCAGCAGAGTGG - Intergenic
982844279 4:160230151-160230173 CACCGTGCCCAGCAGGAGAGAGG + Intergenic
985194581 4:187414882-187414904 CTCTCTGCCCATCAAGAGATGGG - Intergenic
985863428 5:2492773-2492795 CCCTGTGTCCAGCAGCAGCGTGG - Intergenic
986319245 5:6614543-6614565 CTCTCTTTCCAGCAGCAGTGGGG - Intronic
987137249 5:14911922-14911944 CTCTCTGGCCAGGAAGAGGGGGG - Intergenic
990006096 5:50945686-50945708 GTCACTGCCCAGCAGAACCGTGG + Intergenic
996901220 5:128543550-128543572 CTCACTGCCCAGCAGTAATGAGG + Intronic
996912516 5:128671107-128671129 TTCTCTGGCGAGCAGGAGTGGGG + Intronic
997267090 5:132501254-132501276 CTGTCTGCCCAGCAAGACCAGGG + Intergenic
997452325 5:133993928-133993950 TGCTCTGCCCAGGAGGAGAGGGG + Intronic
999120778 5:149207687-149207709 CTCTGTACCCACCAGGAGAGGGG + Intronic
999276857 5:150337291-150337313 CTGTCTAGCCAGCAGGAGCTGGG - Intronic
999649422 5:153750680-153750702 CTCTCTGCCCTTCAGGATGGAGG - Intronic
1000326944 5:160179421-160179443 CCCCATGCCCAGCAGGAGAGGGG + Intergenic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1002941510 6:1720732-1720754 TTCTCTGACCAGCGGGAGCCAGG - Intronic
1003078723 6:3004050-3004072 CTCTCTTCCCAGCTGGACTGTGG - Intronic
1003084615 6:3051672-3051694 CTCTCTTCCCAGCTGGACTGTGG + Intergenic
1003405118 6:5821482-5821504 CCCTCTGCCCAGGTGGAGCTTGG + Intergenic
1005331773 6:24757687-24757709 CTTTCTGCCCAGCAGAATTGAGG - Intergenic
1005425767 6:25701200-25701222 CCCTCAGCCCAGCATCAGCGGGG + Exonic
1006164451 6:32056408-32056430 CTCCCTGCTCAGGAGGAGCCAGG + Intronic
1006335407 6:33417959-33417981 CACTCCGCCGAGCAGGACCGCGG + Intronic
1007518039 6:42429043-42429065 ATCTGTGCCCAGCAGGCGCTGGG + Intronic
1007721321 6:43887088-43887110 GTGTTTGCCCAGCAGGAGCCAGG + Intergenic
1010644424 6:78370055-78370077 CTCTCTGCCCAACAGAGGCAGGG + Intergenic
1011981889 6:93388614-93388636 CTCTCTGACCAGCACGACTGTGG + Intronic
1013255391 6:108379931-108379953 CTCTCTGCACAGGAAGAGTGGGG + Intronic
1013355656 6:109343922-109343944 CTTTCTTCCCAGCAGAAGGGGGG - Intergenic
1013844073 6:114428025-114428047 TTCTCTGGCCGGCAGGAGTGGGG + Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1016683609 6:146857357-146857379 CTCTCTGTCCTGCAGGTGCACGG + Intergenic
1016997316 6:149969769-149969791 CTTTCTCCACAGCAGGAGGGTGG + Intronic
1018446872 6:163866371-163866393 CGCTCTCCCCAGCAGGAGGCAGG - Intergenic
1018836578 6:167488771-167488793 CTCTCTCCCCAACAGGGTCGTGG + Intergenic
1019118762 6:169786575-169786597 CTCTGTTCCCTGCAGGTGCGTGG + Intergenic
1019890024 7:3939106-3939128 TTTCCTGCCCAGCAGGAGGGAGG - Intronic
1020322300 7:6948366-6948388 CTCTCTGGCAGGCAGGAGTGGGG + Intergenic
1020972214 7:14958756-14958778 CTCTGTGCCCAGCAGGTGTCAGG - Intronic
1022503309 7:30895916-30895938 CTCTCTCCCTGGCAGGAGAGTGG + Intergenic
1022619954 7:31972856-31972878 CTCTCTGCCCCCCATGAGCCTGG + Intronic
1023177662 7:37448915-37448937 GTCTCTGGCCAGCAGGAGGAAGG - Exonic
1023622503 7:42087410-42087432 CTCACTGCCCAGCAGAAGGCAGG - Intronic
1024161660 7:46682317-46682339 GACTCTGCCCAGCAGGGGCATGG - Intronic
1024399821 7:48911288-48911310 CTCTGATCCCAGCAGGAGCTTGG - Intergenic
1024815973 7:53272175-53272197 CTCTCTTCCCAGCATGAGGTGGG - Intergenic
1025247633 7:57329029-57329051 CTCACAGCACAGCAGGAGCGAGG + Intergenic
1029508149 7:100975287-100975309 CTGTCTGCCCTGGAGGGGCGGGG + Intronic
1030123514 7:106133628-106133650 CTAGCTGCCCAGCAGCAGCAAGG + Intergenic
1032036424 7:128524901-128524923 CTCCATGCCCAGCAGGAAAGAGG + Intergenic
1033121673 7:138671940-138671962 CTCTCAGCCCTGCAGGATGGAGG + Intronic
1033348859 7:140545764-140545786 CTCTCTGCTCACCGGGAGGGAGG - Intronic
1034875370 7:154720543-154720565 CTCTCTGACATGCTGGAGCGGGG - Intronic
1034997884 7:155589867-155589889 CTCCCAGCCCAGGACGAGCGGGG - Intergenic
1035243755 7:157549094-157549116 CTCTCAGCCCAGAGGGAACGTGG - Intronic
1036127075 8:6072724-6072746 TTCTCTGCCAAGCAGGGGCTGGG + Intergenic
1036642181 8:10591574-10591596 CTCCCAGGCCAGCGGGAGCGAGG + Intergenic
1040866859 8:52056277-52056299 CCCTCTCACCAGCAGGAGCAAGG - Intergenic
1040982821 8:53262840-53262862 CTCTCTGCCATGCATGAGCAAGG + Intergenic
1044955561 8:97476113-97476135 ATCTCTGCTCAGGAGGAGTGGGG - Intergenic
1045328748 8:101137285-101137307 CTTCCTGCCCAGCTGGAGGGAGG + Intergenic
1046271151 8:111899160-111899182 CTCCCCGCCCAGCAGGTGCCTGG + Intergenic
1046294566 8:112201215-112201237 TTCTCTGACAAGCAGGAGTGGGG - Intergenic
1048098047 8:131315658-131315680 TTCTCTGGCGAGCAGGAGTGGGG - Intergenic
1048728725 8:137413651-137413673 CTCTCTGGCTGGCAGGAGTGGGG + Intergenic
1049386105 8:142343908-142343930 CACTCTGTCCAGCAGGAGGGGGG - Intronic
1049755747 8:144310656-144310678 CTCCCAGAGCAGCAGGAGCGCGG + Intronic
1049756476 8:144313317-144313339 CTCTGTGCCCTGCAGGGGTGCGG - Intronic
1049866381 8:144940539-144940561 TTCTCTGACCAGCAACAGCGGGG - Intronic
1050251533 9:3749899-3749921 TTCTCTGTCGAGCAGGAGTGGGG - Intergenic
1051658809 9:19407821-19407843 CTGACTGCCCAGCAGGACCCTGG - Intergenic
1053906936 9:42852133-42852155 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054357001 9:64071358-64071380 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054368686 9:64369133-64369155 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1054528033 9:66153374-66153396 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1056558568 9:87710083-87710105 CTCTCTCCCCTGCAGGTGGGAGG + Intergenic
1057826727 9:98377582-98377604 CTCTGTGCCTAGCAGGTGCCTGG + Intronic
1059252017 9:112894383-112894405 CTCTCTGCCCCTCAGGATCTGGG - Intergenic
1060211819 9:121715167-121715189 CCCCCTGCCCTGCAGGAGCAAGG - Intronic
1060376402 9:123118422-123118444 CACTCTGCCCACCAGCAGGGTGG + Intronic
1060817697 9:126644036-126644058 CGCACTGCCCAGCAGCAGAGAGG + Intronic
1060822926 9:126671865-126671887 CTCTCTGCCCCTCTGGAGGGAGG - Intronic
1060951848 9:127608896-127608918 CTCTCTGCGCCCCAGGAACGTGG + Intergenic
1061003595 9:127916287-127916309 TTCTCTGCTCAGCAGTAGGGAGG + Intronic
1061246929 9:129405381-129405403 TTCTGTGCCCAGCAGAAGAGCGG + Intergenic
1061257137 9:129459678-129459700 CTCTAAGCGCAGCAGAAGCGCGG - Intergenic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1061431531 9:130534351-130534373 CTCTCTGCCCACCTGGGGCTCGG + Intergenic
1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG + Intronic
1061615265 9:131774973-131774995 CTCTCTCCCCAGGAGAAGCCAGG - Intergenic
1061618207 9:131793971-131793993 ATCTGGGCCCAACAGGAGCGTGG - Intergenic
1061867246 9:133499201-133499223 CTATCTGTCCAGCAGGGGCAGGG - Intergenic
1061884929 9:133586610-133586632 TTCACTGCCCAGCAGAAGCAGGG + Intergenic
1062141620 9:134962175-134962197 CTCTCAGGCCAGCAGCAGCAAGG + Intergenic
1062372988 9:136249632-136249654 CTCACTGCCCAGGCGGAGCAGGG - Intergenic
1062382333 9:136292437-136292459 CGCTCTGCCCAACAGGGGCCTGG - Intronic
1203748540 Un_GL000218v1:58097-58119 CTCCCTTCCGAGGAGGAGCGGGG + Intergenic
1203561180 Un_KI270744v1:59923-59945 CTCCCTTCCGAGGAGGAGCGGGG - Intergenic
1191215904 X:57932263-57932285 CTCTCTACCCTTCAGGAGCATGG - Intergenic
1192563550 X:72143694-72143716 CACTCTGGACAGCAGGAGAGAGG + Intergenic
1197579382 X:128262928-128262950 TTCTCTGGCCAGCAGGGGTGGGG + Intergenic
1197753055 X:129978977-129978999 CTCTGGGCCTAGCAGAAGCGAGG + Intergenic
1198258569 X:134946533-134946555 TTCTCTGGCGAGCAGGGGCGGGG - Intergenic
1200100228 X:153686465-153686487 GCCTCAGCCCAGCAGGAGTGCGG - Intronic