ID: 1061589298

View in Genome Browser
Species Human (GRCh38)
Location 9:131588499-131588521
Sequence GGGTTGTCCCAGCACGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061589298_1061589300 -3 Left 1061589298 9:131588499-131588521 CCATGTTCGTGCTGGGACAACCC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1061589300 9:131588519-131588541 CCCAGAACTGACCACAGCCCAGG No data
1061589298_1061589302 -2 Left 1061589298 9:131588499-131588521 CCATGTTCGTGCTGGGACAACCC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1061589302 9:131588520-131588542 CCAGAACTGACCACAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061589298 Original CRISPR GGGTTGTCCCAGCACGAACA TGG (reversed) Intronic
900646675 1:3712080-3712102 GAGGTGTCCCAACACGATCATGG + Intronic
916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG + Intergenic
1064794208 10:18993215-18993237 TGGTTCTCCCAGCACGCACCTGG + Intergenic
1070231588 10:74573498-74573520 TGGTTCTCCCAGCACGCAGATGG - Intronic
1072736493 10:97882797-97882819 GGATTCTCCCAGCAGGAAAATGG - Exonic
1074700373 10:116087138-116087160 GGGTTGTCCCGGCAACATCAGGG - Intronic
1095867868 12:46992447-46992469 TGGTTCTCCCAGCACGAAGCTGG + Intergenic
1101709982 12:107256344-107256366 GGGCTGTCCCAACTCGACCAAGG + Intergenic
1107903666 13:45042993-45043015 GGGTTGGCCCAGAATAAACAGGG + Intergenic
1111322707 13:86651100-86651122 TGGTTCTCCCAGCACGCACCTGG - Intergenic
1119479992 14:74953153-74953175 GGGTGTTCCCAGCACGCAGATGG + Intronic
1124720347 15:32106117-32106139 GGCTTGACCCAGCACGATAATGG + Intronic
1128872705 15:71174762-71174784 GGGTTCTCCCAGCACGCAGCTGG + Intronic
1131092815 15:89634951-89634973 GGGTTCTCCCAGCACGCAGCTGG + Intronic
1132083898 15:98891072-98891094 GGTTTGTCCCAGACCAAACAAGG + Intronic
1137552611 16:49450559-49450581 GGGGTGGCCCAAAACGAACAGGG - Intergenic
1138431522 16:56972136-56972158 GGGTTGTCAGAGCACAAAAAAGG - Intronic
1139655456 16:68384593-68384615 GGGTTGTCTCTGCAGGACCAGGG + Intronic
1144066347 17:11627897-11627919 GGTGTGTCCCAGCAGGAAAAAGG + Intronic
1150001490 17:61443462-61443484 GGGTTGTCCCGGCCCAGACAAGG - Intergenic
1152207908 17:78985091-78985113 GGGTTGTCCCAGCACCATGGTGG + Intergenic
1153993661 18:10421713-10421735 GGGATGTGACAGCAGGAACAAGG - Intergenic
1155158218 18:23175770-23175792 GGGTTGGCTCAGGAGGAACAAGG - Intronic
1156730948 18:40193000-40193022 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1157122212 18:44921836-44921858 GGCTTTTCCCAGCTGGAACAAGG + Intronic
1157690348 18:49676956-49676978 GGGTTGTCCCCACAGCAACATGG + Intergenic
1159515195 18:69449684-69449706 TGGTTCTCCCAGCACGCAGATGG + Intronic
1163334647 19:16662891-16662913 GTGTTGTCCTAGCATGAACATGG + Intronic
1163615939 19:18328344-18328366 GAGGTGTCCCAGCATCAACATGG + Intergenic
1164612597 19:29642997-29643019 GGGTTTTCCCAGGACTAACGAGG + Intergenic
1168039722 19:53748439-53748461 GGGTTGCCCCTGCATGAACAAGG + Intergenic
926454749 2:13052831-13052853 GTGTGGCCCCAGCATGAACAAGG - Intergenic
927671596 2:25073179-25073201 GTGTTGTCCCAGCACACACTCGG + Intronic
929745381 2:44652359-44652381 GGGGTGCCCCACCAGGAACAAGG - Intronic
932669230 2:73722034-73722056 GGGTTCTCCCAGCACGCAGCTGG + Intergenic
937452987 2:122018046-122018068 TGGTTCTCCCAGCACGCAGATGG - Intergenic
938454727 2:131452661-131452683 TGGATGTCCCAGCTCAAACAGGG + Intergenic
940836051 2:158523255-158523277 TGGTTCTCCCAGCACGCAGATGG + Intronic
941079134 2:161040338-161040360 GGGTTGTGCCTGCAGGGACAGGG - Intergenic
941553122 2:166940934-166940956 TGGTTCTCCCAGCACGAAGCTGG - Intronic
943769798 2:191704158-191704180 GGGTTGTCTCAGCTCTGACATGG + Intergenic
1170659589 20:18324040-18324062 AGGTTGTCCCAGCTAAAACATGG + Intergenic
1171404571 20:24901240-24901262 TGGTTGTCCCAGCACGCAGCTGG + Intergenic
1171466374 20:25330588-25330610 TGGTTCTCCCAGCACGCACCTGG + Intronic
1175262178 20:57681508-57681530 GGGTGGTCCCAGCATCAAGAAGG + Intronic
1177138088 21:17328120-17328142 TGGTTCTCCCAGCACGAAGCTGG + Intergenic
1179247409 21:39645730-39645752 AGGTTGTCCCAACTGGAACAGGG - Intronic
1179984360 21:44912762-44912784 GGGTAGCTCCAGCACGCACAGGG - Intronic
1180611531 22:17101329-17101351 GGGTGGTCCCAGGATGAAGAAGG - Intronic
1180869507 22:19138307-19138329 TGCTTGTTCCAGCACAAACAGGG - Exonic
1180991086 22:19936643-19936665 GGGGTGTCCCTGCATGAAGAAGG - Intronic
1181855307 22:25777371-25777393 GGGTTGTCCAAGGACTCACAGGG + Intronic
1182357820 22:29730166-29730188 GGGCTGGCCCAGCAGGTACATGG - Exonic
1184038419 22:41929275-41929297 GGGTAATACCAGCACCAACATGG - Intergenic
1185223555 22:49640831-49640853 GAGTGGTCCCAACACGCACAAGG + Intronic
954406828 3:50349872-50349894 GGGTTGTCCCAGGAGGAGGAAGG - Intronic
956076350 3:65509928-65509950 TGGTTCTCCCAGCACGCAGAAGG + Intronic
959994370 3:112664506-112664528 TGGTTCTCCCAGCACGCACCTGG - Intergenic
964256140 3:154776653-154776675 AGGTGGTCACAGCAGGAACAAGG + Intergenic
968115349 3:196085165-196085187 GGGTTGTACCAGCTCTAAAATGG + Intergenic
974740353 4:65998654-65998676 GGGTTCTCCCAGCACGCAGCTGG - Intergenic
977492930 4:97736857-97736879 TGGTTCTCCCAGCACGCAGATGG + Intronic
978632480 4:110762974-110762996 TGGTTGTCCCAGCACGCAGCTGG - Intergenic
979787827 4:124738930-124738952 GGCTTCTCCCAGAACGAGCAAGG + Intergenic
982176895 4:152714431-152714453 GGGTTGTTCCTGCATGGACAAGG - Intronic
983385471 4:167055950-167055972 TGGTTCTCCCAGCACGAAGCTGG + Intronic
983402360 4:167281502-167281524 TGGTTCTCCCAGCACGAAGCTGG - Intergenic
986059743 5:4176692-4176714 GGATTATCCCAGCAGAAACATGG - Intergenic
993758510 5:91762773-91762795 TGGTTCTCCCAGCACGCAGATGG + Intergenic
997595671 5:135105714-135105736 GGGTTGCCCAAGCAGGACCATGG - Intronic
998776477 5:145609504-145609526 GGGCTGACCCAGCAAGAATATGG - Intronic
999548626 5:152659319-152659341 TGGTTCTCCCAGCACGAAGCTGG - Intergenic
1007289454 6:40774215-40774237 GGGTTCTGCCAGCAAGAAGAAGG + Intergenic
1008276789 6:49551430-49551452 GGGCTCTCCAGGCACGAACAGGG + Exonic
1009188377 6:60600473-60600495 TGGTTCTCCCAGCACGCAGATGG + Intergenic
1015697755 6:136000846-136000868 TGGTTGTCCCAGCACGCAGCTGG + Intronic
1019612050 7:1941575-1941597 GGCTGGTCCCAGCCCGGACACGG - Intronic
1022027149 7:26459347-26459369 GTGGTGTCCCAGCTCCAACAAGG - Intergenic
1022035101 7:26526575-26526597 GGGCTGTCCCAGCACCCACTGGG - Intergenic
1027648986 7:80841046-80841068 GGGTTTTCTCAGCAGAAACAAGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028164066 7:87517828-87517850 GAGGTGTCCAGGCACGAACATGG - Intronic
1028946403 7:96585334-96585356 TGGTTCTCCCAGCACGAAGCTGG - Intronic
1035311340 7:157970892-157970914 GGCTTGTCCCTGCACGCACGAGG + Intronic
1036064200 8:5359373-5359395 GGGTTGTCATAGGAGGAACAAGG + Intergenic
1038356056 8:26830438-26830460 GTGTTATCCTAGAACGAACAAGG - Intronic
1040989884 8:53338293-53338315 TGGTTCTCCCAGCACGCAGATGG + Intergenic
1041949922 8:63489677-63489699 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1045268826 8:100644416-100644438 GGGTGGTGCCAGCAAGAGCAGGG + Intronic
1046554075 8:115753800-115753822 TGGTTCTCCCAGCACGCAGATGG + Intronic
1046765302 8:118062696-118062718 GGGTTTTGCCAGCAGGAAAAGGG + Intronic
1050187388 9:2988574-2988596 GGGTGGTCCCAGCATGAGCAGGG - Intergenic
1054980690 9:71202324-71202346 TGGTTCTCCCAGCACGCACATGG - Intronic
1055866151 9:80816497-80816519 TGGTTCTCCCAGCACGCAGATGG + Intergenic
1056077303 9:83054912-83054934 TGGTTCTCCCAGCACGCAGATGG - Intronic
1058211397 9:102174178-102174200 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1058516579 9:105782423-105782445 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1061363448 9:130158000-130158022 GGGTCGACACAGCAGGAACAAGG - Intergenic
1061589298 9:131588499-131588521 GGGTTGTCCCAGCACGAACATGG - Intronic
1190510613 X:51170413-51170435 GGGCTTTCCCAGCACTAACTAGG - Intergenic
1192900316 X:75489244-75489266 TGGTTCTCCCAGCACGCAGATGG + Intronic
1194938330 X:99978925-99978947 GGGATGTTACAGCATGAACAGGG - Intergenic
1197889209 X:131250918-131250940 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1199967827 X:152834445-152834467 GGGTTGCCCCAGCATAATCAAGG + Intronic
1200496281 Y:3887219-3887241 AGGTTGTCCCATCACAAGCATGG - Intergenic
1201795284 Y:17890182-17890204 TGGTTCTCCCAGCACGCAGATGG + Intergenic
1201806272 Y:18015803-18015825 TGGTTCTCCCAGCACGCAGATGG - Intergenic
1202356719 Y:24059264-24059286 TGGTTCTCCCAGCACGCAGATGG + Intergenic
1202514059 Y:25610846-25610868 TGGTTCTCCCAGCACGCAGATGG - Intergenic