ID: 1061590415

View in Genome Browser
Species Human (GRCh38)
Location 9:131594250-131594272
Sequence CTCAAAGACCAGGTGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061590415_1061590427 29 Left 1061590415 9:131594250-131594272 CCCTGGCTCACCTGGTCTTTGAG 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1061590427 9:131594302-131594324 TCATTTTCCTCCTAAGGAATCGG No data
1061590415_1061590418 -9 Left 1061590415 9:131594250-131594272 CCCTGGCTCACCTGGTCTTTGAG 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1061590418 9:131594264-131594286 GTCTTTGAGACAGCCCTAAAAGG No data
1061590415_1061590424 23 Left 1061590415 9:131594250-131594272 CCCTGGCTCACCTGGTCTTTGAG 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1061590424 9:131594296-131594318 TGTCCCTCATTTTCCTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061590415 Original CRISPR CTCAAAGACCAGGTGAGCCA GGG (reversed) Intronic
901261350 1:7874249-7874271 CTCAAAGCCCATGAGGGCCAAGG - Intergenic
901394605 1:8971849-8971871 CACAGAAACGAGGTGAGCCAAGG - Intronic
901973331 1:12925327-12925349 CTCAACCACCAGGTGAACCTGGG - Intronic
902011847 1:13276436-13276458 CTCAACCACCAGGTGAACCTGGG + Intergenic
903058424 1:20652977-20652999 ATAAAAGGCCAGGTTAGCCAGGG + Intronic
903112276 1:21146293-21146315 CTGAAAGCTGAGGTGAGCCATGG + Intronic
903326290 1:22570732-22570754 CTCAGGGACCTGGAGAGCCAGGG - Intronic
906899921 1:49823913-49823935 ATAAAAGACCAGGTGAGGCCAGG + Intronic
908754759 1:67459183-67459205 CTCAAAGCCTGGGGGAGCCAGGG + Intergenic
909594893 1:77395595-77395617 CTCAAAGACAAAGTGAGCACAGG - Intronic
910748822 1:90605187-90605209 CTGAAAGCCCAGGTGGGCCTGGG - Intergenic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
911683552 1:100746701-100746723 TTCAGAGACCAGGAGAGTCAGGG - Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
916255809 1:162787056-162787078 CTCAGAGACCAGGTAAGAAATGG - Exonic
916573144 1:166044735-166044757 CTCAGGGACCAAGTTAGCCATGG - Intergenic
917620788 1:176793658-176793680 GTCAAAGTCCAGGTGAGGAAAGG + Exonic
917970151 1:180201083-180201105 TTCACAGACGAGCTGAGCCAAGG - Exonic
918238519 1:182601996-182602018 CTCAAAGATCTGGTGTGCCCTGG + Exonic
919521285 1:198591544-198591566 CTAAATGACGAGGTGAGGCATGG + Intergenic
919650953 1:200148276-200148298 CCCCAAGAACAGGAGAGCCATGG - Intronic
920173315 1:204084731-204084753 ATCAGTGACCAGGTCAGCCAGGG + Intronic
922816327 1:228452380-228452402 CTCCAAGACCGTGTGTGCCAGGG - Intergenic
1063359036 10:5433596-5433618 ATGAAAGAAAAGGTGAGCCATGG - Intronic
1063454625 10:6174486-6174508 CTCCAAGCCCAGGTCAGCCCGGG - Intronic
1063468261 10:6262764-6262786 CTCAAAGACTAGAGGAGCAAAGG + Intergenic
1065287360 10:24198989-24199011 TGGAAAGACCAGGTGAGGCAAGG + Intronic
1066722274 10:38352726-38352748 CTCAGAGACCAGGTAAGAAATGG - Intergenic
1067178762 10:43969615-43969637 CACGCTGACCAGGTGAGCCAGGG - Intergenic
1071506760 10:86237055-86237077 CCCAAAGCCCAGGAAAGCCAGGG + Intronic
1072428603 10:95351680-95351702 GCAAAAGGCCAGGTGAGCCAGGG + Intronic
1073558824 10:104480077-104480099 CTCAGAGACCAGGCTAGACAGGG - Intergenic
1074060216 10:109958527-109958549 GTCAAGGGCAAGGTGAGCCAGGG + Intergenic
1074776783 10:116773060-116773082 CTAAAAGTCTGGGTGAGCCAGGG + Intergenic
1076854570 10:133109495-133109517 CTCAAAGGGCAGGTGAGGCCAGG - Intronic
1077409033 11:2395035-2395057 AACAAGGACCAGGTGAGCCTGGG + Exonic
1077905128 11:6526806-6526828 CTCCAAGAACAGGTGAGGTAAGG - Intronic
1078083024 11:8217688-8217710 CTGAAAGCCCAGGTGAAGCAGGG + Intergenic
1079920569 11:26429019-26429041 CTCAGTGACCCAGTGAGCCACGG - Intronic
1080331683 11:31146764-31146786 GTCACAGACCAGTTAAGCCAAGG - Intronic
1080784735 11:35464420-35464442 CTCAAAGATCAGTAGTGCCAAGG - Intronic
1081253535 11:40864603-40864625 CAATAAGAGCAGGTGAGCCATGG - Intronic
1085237538 11:75026505-75026527 CCCTAAGACCAGGCTAGCCAGGG - Intergenic
1086131879 11:83409601-83409623 CTCAAAGAGCAGGTGGGCTCTGG - Intergenic
1086167624 11:83797848-83797870 CTCAAGGATCTGGTGATCCAGGG + Intronic
1088026547 11:105191222-105191244 CTCAAATACCTGGTGATCCTTGG - Intergenic
1088595630 11:111438329-111438351 CTGAGACACCATGTGAGCCAGGG + Intronic
1089750821 11:120649952-120649974 GGCAAAGACCACATGAGCCAAGG - Intronic
1092962774 12:13611771-13611793 CTCAAAGACAAAGACAGCCACGG + Exonic
1096554819 12:52396872-52396894 GTCAAAGCCCAGGTGAGGCTGGG - Exonic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1101836636 12:108300229-108300251 CTCCAGGAGCAGGTGCGCCAGGG + Intronic
1102900889 12:116635848-116635870 CTCAGAGCCCTGGTGAGGCAAGG - Intergenic
1103211643 12:119171406-119171428 CTCAAAGACCTTGTGACCCAAGG + Intergenic
1103321453 12:120094918-120094940 CTCCATGAACAGGTGGGCCAGGG - Intergenic
1106007459 13:25784279-25784301 CTCAAAGTTCACGTGAGCCCTGG - Intronic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1106437011 13:29732247-29732269 GTCAAAAACCAGGTGGGGCAGGG + Intergenic
1106491603 13:30229254-30229276 CACCAAGACCAGGGGAGTCATGG - Intronic
1106793169 13:33177526-33177548 CTCAAGGACCAGCTGAGCTGGGG + Intronic
1110730136 13:78870805-78870827 CTGAAAGACCAGGGAAGCAATGG + Intergenic
1113403474 13:110017425-110017447 CTCTGAGAGCAGGTGAGCCAAGG + Intergenic
1118861005 14:69663488-69663510 TTCCAAGATGAGGTGAGCCAGGG - Intronic
1119860232 14:77930923-77930945 CTTAAAGACCAGGTAGGTCAAGG + Intronic
1121343386 14:93117898-93117920 CTGAAAGACCAGTTGAGGCTGGG + Intergenic
1122544534 14:102514879-102514901 CTTAAAGGCCAGGTGAGCTTTGG - Intergenic
1122673147 14:103387412-103387434 CTCTTAGACTAGGTGAGTCAGGG + Intronic
1122688031 14:103519127-103519149 CCCAATGACCAGTGGAGCCAGGG + Intergenic
1123106014 14:105841389-105841411 GGCAAAGACCCGTTGAGCCATGG + Intergenic
1123436930 15:20261590-20261612 TTCTCAGAACAGGTGAGCCAAGG - Intergenic
1123489067 15:20765357-20765379 GGCAAAGAGCAGGTGAGCCCTGG + Intergenic
1123545566 15:21334444-21334466 GGCAAAGAGCAGGTGAGCCCTGG + Intergenic
1125513059 15:40303097-40303119 CTCAGAGCCCAGGCGAGCCCAGG + Intronic
1125522008 15:40353524-40353546 CTCAAGGCCCAGGGGAGCTAGGG + Intronic
1125642606 15:41243859-41243881 CTCAAAGACCAGTAGAGAAATGG - Intronic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1127758282 15:62113736-62113758 AACAAAGGCCAGGGGAGCCAGGG + Intergenic
1128568016 15:68714030-68714052 CTCTGGGACCAGGTCAGCCACGG + Exonic
1129711649 15:77823369-77823391 CTCAGAGTCCAGATGAGACAGGG + Intergenic
1130250944 15:82300120-82300142 CTGAATGACTAGGTGAGCCTGGG - Intergenic
1131232790 15:90671788-90671810 CTGGAAATCCAGGTGAGCCATGG - Intergenic
1202953910 15_KI270727v1_random:61714-61736 GGCAAAGAGCAGGTGAGCCCTGG + Intergenic
1132723174 16:1327053-1327075 CCCAAAGCCCAGGGGAGCCAGGG - Intergenic
1133303723 16:4797703-4797725 CTCAAGGACAAGGTGGGCCCGGG - Exonic
1136513922 16:30756509-30756531 GTCAAAGACCTGGTGAGCGGGGG + Exonic
1138286186 16:55812035-55812057 TTCATAGGCCAGGTGTGCCAAGG - Intronic
1139582113 16:67879960-67879982 CTCCTTGACCAGGTGAGGCAAGG + Exonic
1140750353 16:78017924-78017946 CCCAAAGACAAGGTGGGGCAGGG + Intergenic
1143540493 17:7565576-7565598 CTCAATGACCAGGTGAGAAAGGG + Exonic
1148578562 17:48727958-48727980 CTCAGAGACAAGGGGACCCAGGG + Intronic
1149866843 17:60156000-60156022 CCCCAACACCAGGTGGGCCAGGG - Intronic
1151498060 17:74471477-74471499 CTCAAAGGCCATATGAGTCAGGG + Intronic
1151882650 17:76904411-76904433 CCCAAAGTCCAGGTGGGCCTGGG + Exonic
1151936850 17:77267094-77267116 CCCCCAGACCAGGCGAGCCAGGG - Intergenic
1152098391 17:78286461-78286483 CTGAAAGCCCAGGGGAGGCAGGG - Intergenic
1152195522 17:78916095-78916117 CACAAAGACAGGGAGAGCCAGGG + Intronic
1153667526 18:7379493-7379515 CTCAGAGACCAGGGGTACCAGGG - Intergenic
1158805199 18:60963489-60963511 CTTAAAGATCTGGTGAGACATGG + Intergenic
1159610620 18:70521225-70521247 TTCAAAAACCAGGTGAGATATGG - Intergenic
1160133631 18:76252084-76252106 CTCCAAGCCCTGGTGCGCCAAGG + Intergenic
1160296928 18:77647451-77647473 CTCTCAGACCACCTGAGCCAGGG + Intergenic
1162821495 19:13226157-13226179 CACAAAGACCAGGAGAGGAAGGG + Intronic
1163144174 19:15369611-15369633 CTCAAAGACCCAGTGGGCCTGGG + Intronic
1163612441 19:18308467-18308489 TTCAAACAGCAGGAGAGCCAAGG + Intronic
1166716972 19:44974716-44974738 GTCACAGACCATGTGAGCCCAGG - Intronic
1167102806 19:47414706-47414728 CTCCCAGACCAGGTGGGCCCGGG - Exonic
1167111723 19:47466383-47466405 CACCAAGGCCAGGGGAGCCATGG + Exonic
925213145 2:2068366-2068388 GTCACAGAGCAGGTCAGCCATGG + Intronic
927215894 2:20667609-20667631 TTCACAGACCAGGCGACCCAAGG + Exonic
928444545 2:31321235-31321257 CCCTAAGACCAGGTGGACCACGG - Intergenic
928692662 2:33816861-33816883 GTCAAAGCCAAAGTGAGCCAAGG - Intergenic
929128172 2:38539457-38539479 CTCCAGCAGCAGGTGAGCCAAGG + Intergenic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
930245787 2:48982144-48982166 CTTAAAGGCCATGAGAGCCACGG + Intronic
932333853 2:70918216-70918238 CTCAGGGAAAAGGTGAGCCAGGG - Intronic
934993808 2:98939255-98939277 CCCATTGCCCAGGTGAGCCATGG + Intergenic
937299950 2:120832981-120833003 CTCAGGGACCAGGTCAGACATGG + Intronic
937732373 2:125248996-125249018 CTCATAGGCCAGGAGAGACAGGG - Intergenic
940623882 2:156148811-156148833 CTCAAAGACCAGTTAAAGCAGGG + Intergenic
944370234 2:198973966-198973988 ACTAAAGACCTGGTGAGCCAGGG - Intergenic
946170917 2:217894995-217895017 CTCCATGCCAAGGTGAGCCAGGG - Exonic
947057156 2:226118143-226118165 CTCAAAGTCCAGGTGTGATAGGG - Intergenic
1169908357 20:10625855-10625877 CTCAAATAACAAGAGAGCCAGGG - Exonic
1173414176 20:42840970-42840992 GCCAAAGGCCAAGTGAGCCAAGG - Intronic
1175916045 20:62426452-62426474 CTCCAAGGCCAGGTGGGCCCCGG - Intronic
1176191382 20:63811758-63811780 CTCACTGGGCAGGTGAGCCATGG + Intronic
1178673365 21:34611929-34611951 CCCAAAAACCAGGTGGGCTAAGG - Intronic
1179221130 21:39408525-39408547 CCCAAACACCAGGTGAGCCAGGG + Intronic
1179225497 21:39449351-39449373 CACAAAGACCAGGAGATCCACGG - Intronic
1180096607 21:45558256-45558278 CCCCAAGTCCAGGTGGGCCACGG + Intergenic
1181997478 22:26894071-26894093 TGGAAAGAACAGGTGAGCCAGGG - Intergenic
1182827267 22:33276743-33276765 CTCAAAGACCAAGTGATGAATGG + Intronic
1183432416 22:37773760-37773782 CTGAAAGACAAGGTGCGGCAGGG - Intronic
1184650129 22:45915837-45915859 CTCCATGACCAAGTGTGCCATGG - Intergenic
949563237 3:5221757-5221779 CACAAAGACCAGGTGTGCTGGGG - Intergenic
949652794 3:6180364-6180386 CTCATGGACCAAGTGAGCCAGGG + Intergenic
950506210 3:13396346-13396368 TTCAAAGACAAAGTGAGCCTTGG + Intronic
953790834 3:45946702-45946724 GACAAACACCAGGTCAGCCAGGG - Exonic
954041796 3:47893522-47893544 CTCAAAGCCCAGGGCAGCAAAGG - Intronic
961143473 3:124574962-124574984 CTCAAGGAGCAAGTGAGACAGGG - Intronic
961167004 3:124770316-124770338 CTCAAGAGCCAGGTGTGCCAGGG + Intronic
962157630 3:132965269-132965291 CTCAAAGACAAGGAGGGGCATGG + Intergenic
962176328 3:133159456-133159478 CTCAAAGATCAGGTCATCAAAGG - Intronic
962389125 3:134957104-134957126 CTCCAAGCCCAAGAGAGCCATGG + Intronic
968231339 3:197006538-197006560 GACAAGGCCCAGGTGAGCCAGGG - Exonic
968463216 4:736412-736434 CACAAAGACCAGGAGACCCCAGG + Intronic
968789552 4:2650214-2650236 TCCACAGACCAGGTGAGGCAAGG - Intronic
968958135 4:3729401-3729423 GTCAAAGAACTGGGGAGCCATGG - Intergenic
969574790 4:8030517-8030539 CTGACAGGCCAGGGGAGCCATGG - Intronic
970181621 4:13403094-13403116 TTCAAAGAATATGTGAGCCAGGG - Intronic
972977926 4:44660403-44660425 CTCAAAGAACAAGTGTTCCAAGG - Intronic
976195389 4:82527144-82527166 AACACAGATCAGGTGAGCCAAGG - Intronic
985128186 4:186715669-186715691 TCCAAAGACCATCTGAGCCAAGG + Intronic
985172152 4:187162889-187162911 ATCAAAGGCCAGGAGAGGCAGGG - Intergenic
985189223 4:187353539-187353561 CTCAAAGACCTGGCGGCCCAGGG - Intergenic
986431802 5:7688557-7688579 ATCAAAGACCTGGTCAGGCACGG - Intronic
990392021 5:55332907-55332929 CACAATGACCAGATAAGCCAAGG - Intronic
990914403 5:60888185-60888207 CTCAAAAACAATGTGAGGCATGG + Intronic
992946989 5:81820825-81820847 CTCCAAGACCAGGTGGGCAGAGG - Intergenic
993295487 5:86133659-86133681 CTCAGTGACCAGGTCAGACAAGG - Intergenic
996714906 5:126579325-126579347 CTCCAAGAGAAGGTTAGCCAAGG - Intronic
996899283 5:128525166-128525188 CTGAAAGATCAGTTGAGGCAAGG + Intronic
997248727 5:132372520-132372542 CCCAAAGGCCAGCTGTGCCAGGG + Intronic
999288525 5:150408357-150408379 CTCAAAGACATGGAGAGCCTGGG - Intronic
1002071998 5:176684520-176684542 CTCAAATCCCAGATTAGCCATGG + Intergenic
1002631956 5:180588199-180588221 CCCAAAGACCAAGGGAGCTAAGG - Intergenic
1005828939 6:29655116-29655138 CCCAAAGACCATGTCAGCCAAGG + Intergenic
1006672576 6:35738507-35738529 CTCAAAATCCAGGTGAGCCCAGG + Exonic
1008710153 6:54215188-54215210 CTCAATGATCAGAGGAGCCAAGG - Intronic
1008979904 6:57471266-57471288 CAGAAAGAGCAGGAGAGCCAAGG + Intronic
1009168008 6:60364188-60364210 CAGAAAGAGCAGGAGAGCCAAGG + Intergenic
1010150786 6:72729557-72729579 CTCATAAACCAGGCCAGCCATGG - Intronic
1011610402 6:89145853-89145875 CTCAAAGGCCAGAGCAGCCAAGG + Intergenic
1011983747 6:93418147-93418169 CTGAAAGACCAGGGGGGCGACGG + Intronic
1014294710 6:119604253-119604275 ATAACACACCAGGTGAGCCAGGG - Intergenic
1014672324 6:124320963-124320985 CTCACAGTCCAGGAGAGGCAGGG - Intronic
1017947990 6:159111387-159111409 ATTAAACACCAGGTGAGACAAGG + Intergenic
1018936745 6:168278800-168278822 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1018936762 6:168278874-168278896 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1018936778 6:168278948-168278970 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1021164871 7:17325183-17325205 CTCAAGTACCAGGAGACCCAAGG - Intronic
1023351494 7:39324272-39324294 CTCAGAGAGCGGGAGAGCCAGGG - Intronic
1027344441 7:77242823-77242845 CTCAAAGACCTTGTAAGCCCTGG + Intronic
1028799329 7:94944298-94944320 CTGAAAGAACAGGTGATCAAAGG - Intronic
1032950173 7:136900073-136900095 CTCACATACCTAGTGAGCCATGG + Intronic
1035191964 7:157177715-157177737 CGCAAAGCCCAGGAGAGACAGGG - Intronic
1037681284 8:21099742-21099764 CCCAGAGACCAGGTGAGGAAGGG - Intergenic
1037823497 8:22147194-22147216 CCCAAAGACAGGGTGAACCAGGG + Exonic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1040857305 8:51961387-51961409 CTCAGAGGAAAGGTGAGCCAAGG + Intergenic
1041595718 8:59649030-59649052 CTCAAAACCTAAGTGAGCCAAGG + Intergenic
1046415081 8:113903141-113903163 TTCACAGACCAGGCGAGCCCTGG + Intergenic
1048882614 8:138883169-138883191 CCCCAAGAACAGGAGAGCCATGG - Exonic
1049097902 8:140559605-140559627 CTCATAGGCCAGGCCAGCCATGG + Intronic
1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG + Intergenic
1052120232 9:24705888-24705910 ATCAAAGACCAGATGAGGCCAGG + Intergenic
1053196905 9:36126602-36126624 TTCCAAGGCCAGGTGAGCCTGGG + Intergenic
1056113046 9:83415131-83415153 CTCACAGGTCAGGGGAGCCAGGG + Intronic
1057651611 9:96924844-96924866 CTTCAAGGCCAGGTGAGCAAGGG + Intronic
1057948583 9:99351779-99351801 CTCAAAGACCAGGCCCACCAGGG - Intergenic
1059465279 9:114465470-114465492 CTCAAAGGCCACCTGTGCCATGG + Intronic
1060502910 9:124176136-124176158 CACAAAGACCAGGTCGGGCATGG - Intergenic
1060547621 9:124470354-124470376 CTCTAAGTCCTGCTGAGCCATGG + Intronic
1060733570 9:126052452-126052474 CTTGAGGACCAGGTGAGCCCTGG + Intergenic
1061175980 9:128997410-128997432 CTCAAAGAGGAGGTGAACCTGGG + Intronic
1061309331 9:129752119-129752141 TTCAAAGGCGAGGTGAGGCAAGG - Intronic
1061451271 9:130668121-130668143 ATCAAGGACCAGGTAAGGCAGGG - Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1061649496 9:132035670-132035692 CTCCAAGGCCTGGTCAGCCATGG + Intronic
1061908321 9:133710097-133710119 CTTGGGGACCAGGTGAGCCAGGG - Intronic
1062579885 9:137224802-137224824 CTCAAAGCCCCGGCGAGGCAGGG - Exonic
1190247387 X:48699648-48699670 GTCAGGGTCCAGGTGAGCCAGGG + Intronic
1198816899 X:140600919-140600941 CTAAAAGACCAGCAGGGCCAGGG - Intergenic
1199310138 X:146312107-146312129 CTCTGAGACCACGTCAGCCAGGG + Intergenic