ID: 1061591012

View in Genome Browser
Species Human (GRCh38)
Location 9:131597564-131597586
Sequence GTGCAGTGCTAGAAGTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061591012_1061591018 -4 Left 1061591012 9:131597564-131597586 CCTTTGTACTTCTAGCACTGCAC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1061591018 9:131597583-131597605 GCACGGCAGGAGGGAGAGGCAGG No data
1061591012_1061591017 -8 Left 1061591012 9:131597564-131597586 CCTTTGTACTTCTAGCACTGCAC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1061591017 9:131597579-131597601 CACTGCACGGCAGGAGGGAGAGG No data
1061591012_1061591019 -3 Left 1061591012 9:131597564-131597586 CCTTTGTACTTCTAGCACTGCAC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1061591019 9:131597584-131597606 CACGGCAGGAGGGAGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061591012 Original CRISPR GTGCAGTGCTAGAAGTACAA AGG (reversed) Intronic
903253806 1:22077307-22077329 GCTCAGTGCTAGAAGTATAGTGG + Intronic
906275983 1:44516180-44516202 GTTAAGTGCTGGAAATACAAAGG + Intronic
906987510 1:50700363-50700385 GTGCTTTACTAGAATTACAAAGG - Intronic
910375546 1:86565864-86565886 GTGCAATTTTAGAAGTACATGGG + Exonic
912236407 1:107855934-107855956 GTGCAGTGCTTGAGGTCCAAAGG + Intronic
912712991 1:111962749-111962771 GCGCAGTGGTATAAATACAAAGG - Intronic
916384357 1:164250537-164250559 GTACAGTAATACAAGTACAATGG - Intergenic
924165594 1:241278800-241278822 GTGCAGTGAAAGAAGTCAAAAGG - Intronic
1065111599 10:22445305-22445327 GGGCAGTGAGAGAAGTAGAAAGG - Intronic
1070463489 10:76693161-76693183 GTGCAATGGTAAAAGGACAAGGG + Intergenic
1070587979 10:77780638-77780660 GTGCAGCTCAAGAAGTACCAGGG - Intergenic
1074039683 10:109776031-109776053 AAGCAGCGCTAGAAGTAAAATGG - Intergenic
1075738893 10:124681367-124681389 GCTCAGTGCTAGGGGTACAAGGG - Intronic
1078846544 11:15123891-15123913 GTGCAGTGTTAGAGGTAGGAAGG - Intronic
1081858219 11:46317112-46317134 AGGCAGTGCTAGAAGTAAGAGGG - Intronic
1084041289 11:66544146-66544168 CTGTAGTGCTAGAACTAGAAGGG - Intronic
1086384317 11:86291566-86291588 TTGCATAGCCAGAAGTACAAAGG + Intergenic
1087512390 11:99114187-99114209 CTGCAGAGCTAGAAAGACAAAGG - Intronic
1087663158 11:101011158-101011180 GTGCAGTGCTAGACCTGAAAAGG + Intergenic
1091279127 11:134372008-134372030 GTGCAGTGCTAACAGGACAGGGG - Intronic
1091555883 12:1573209-1573231 GCGCTGTGCTAGAAATGCAAAGG + Intronic
1095414808 12:41965217-41965239 GTGCAGTGGTAGAAGGAGCAGGG - Intergenic
1096195274 12:49645617-49645639 GTGCAGTACTGGAAGCACCAGGG + Exonic
1097969763 12:65620746-65620768 GTGCAGTGATAAACATACAAGGG - Intergenic
1099580209 12:84436386-84436408 GTGCAGGTCTTGAAGTCCAAAGG + Intergenic
1105787670 13:23765668-23765690 CTGCAGTACTGGAAGCACAACGG + Intronic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1109289937 13:60461650-60461672 ATCCAGTGCTGGAGGTACAAAGG + Intronic
1109788540 13:67215852-67215874 GTTCAGTGTTAGAAATACAAAGG + Intronic
1111114050 13:83753208-83753230 GTGCAGTGCTGGGATTACAAGGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1115705441 14:35993648-35993670 GCGCAGTGATGGAAGTGCAAAGG + Intergenic
1117496272 14:56308585-56308607 GTGCAGTGCCTGGAGTACAATGG - Intergenic
1117784902 14:59272816-59272838 GTGCAGTGCTAAAATTCCTATGG + Intronic
1119268775 14:73282489-73282511 TTGCAGTGCCAGAAGTAGAAGGG - Exonic
1122505000 14:102226690-102226712 GTGCAGGGCGGGAAGTCCAAGGG + Intronic
1124631138 15:31338246-31338268 GTGCAGTGCTAGATGTGCAAAGG - Intronic
1126221700 15:46221722-46221744 GAGCAGTGCTAGAAGTGAATGGG - Intergenic
1128704623 15:69829716-69829738 GTACATTCCTAGAAGTAGAATGG + Intergenic
1130108160 15:80944401-80944423 GTTCTGTGCTAGAAATGCAAAGG - Intronic
1140096308 16:71878549-71878571 GAGTAGTGCTAGAAGTAAAGAGG + Intronic
1143232811 17:5371749-5371771 CTGCAGTGATAAAAGGACAAAGG - Intronic
1144662585 17:17080852-17080874 GTGCAGTGCCAGTCGTAGAATGG + Intronic
1146305158 17:31724902-31724924 GGGCAGTGTTAGAAGGACATTGG - Intergenic
1159064340 18:63553221-63553243 GTGTAGTGCCAGAATTAGAATGG + Intergenic
1159524790 18:69574416-69574438 GTGCAATGTTAAAAGTACACAGG + Intronic
1159952481 18:74495812-74495834 GTGCAGTGCTGGATGCGCAAGGG + Intronic
1163890575 19:20008712-20008734 GTGCAGTGCCAGCAGTTGAAGGG + Intronic
1165173182 19:33907231-33907253 ATGCTGATCTAGAAGTACAATGG + Intergenic
1166609087 19:44173073-44173095 GAGCAGGGCAAGCAGTACAAAGG - Intronic
925439937 2:3876718-3876740 ATGCAGTGCTAGCAGCAGAAGGG - Intergenic
925582061 2:5420768-5420790 GAGCCCTGCTGGAAGTACAATGG - Intergenic
925594916 2:5545409-5545431 GTGAACTGCTAGAAATACAATGG + Intergenic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
933229557 2:79790567-79790589 GTGTAATGTTAGAAATACAATGG + Intronic
940682950 2:156808782-156808804 GTTCAGTGCTGGCAATACAACGG + Intergenic
940704459 2:157086286-157086308 GTGTAGTGGTACAAATACAATGG - Intergenic
941089825 2:161161161-161161183 GTGCTTTTCTAGAAGTAGAAAGG + Intronic
941380509 2:164786775-164786797 TAGCAGTTCAAGAAGTACAATGG - Intronic
943219558 2:185088179-185088201 CTGCAGAGCAAGAAGTACAGTGG - Intergenic
944589220 2:201201630-201201652 TGGCAGTACTAGAAGTGCAAAGG + Intronic
947253586 2:228136448-228136470 CTGCAGTGGTAGCAGTACAGTGG - Intronic
1172391506 20:34568313-34568335 GCTCAGTGCTGGAAGGACAAAGG + Intronic
1175487678 20:59357015-59357037 CTGCAGTGCCAGAAGCAAAATGG - Intergenic
1178423300 21:32459042-32459064 GTGCTGTGTTAGAAGAACACAGG - Intronic
1178727229 21:35064756-35064778 CTGCAGTGATTGAAGTTCAATGG - Intronic
1184995816 22:48206692-48206714 CTGCATTGCTAGGAGTGCAAAGG + Intergenic
1185408055 22:50667111-50667133 GTGCTGGGCTAGTGGTACAAGGG + Intergenic
950267903 3:11588764-11588786 GTGAAGTGCTGGAAGAACAATGG + Intronic
951489092 3:23248857-23248879 TTGCAGTGCTAGAGGAACATTGG + Intronic
952474198 3:33689263-33689285 GTTCAAAGATAGAAGTACAAGGG + Intronic
963794117 3:149614326-149614348 GTACAGTGGTACAAATACAATGG - Intronic
967306541 3:188064970-188064992 TTGCAATTCTTGAAGTACAATGG + Intergenic
968111140 3:196047829-196047851 GTGCATTGCTTGAGGTACAAGGG + Intronic
973572968 4:52258900-52258922 TTGCTGTGCTACAAGTCCAAGGG - Intergenic
974624506 4:64405337-64405359 CAGGAGTGCTAGAAGTAGAAGGG + Intronic
974835903 4:67250655-67250677 GTGGAGTGCTAGAGGTAGAAGGG + Intergenic
976129105 4:81865650-81865672 GAGCAATGTTGGAAGTACAAGGG - Intronic
983975592 4:173929728-173929750 GTTCTGTGAAAGAAGTACAAAGG - Intergenic
986166581 5:5277713-5277735 CTACAGTGCTAGAATTACAGGGG - Intronic
990340796 5:54821134-54821156 GTGCTGAGCTAGAAATAAAAGGG + Intergenic
994437076 5:99750142-99750164 TTACAGTGGTACAAGTACAAAGG + Intergenic
997300316 5:132798908-132798930 GTTCAGAGCTAAAAATACAAAGG - Intronic
1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG + Intronic
1014790637 6:125668170-125668192 CTTCAGTGTTGGAAGTACAAGGG - Intergenic
1016137711 6:140566540-140566562 GTTGAGTACTAGAAATACAAAGG - Intergenic
1022168772 7:27801622-27801644 GTAGAGTGCTAGAAGTGTAATGG + Intronic
1024955514 7:54915196-54915218 GTTCAGTGCTAGAAGTCCTAAGG + Intergenic
1028481450 7:91310741-91310763 GTGCAGGGGTACAAGTACATAGG - Intergenic
1030926211 7:115458394-115458416 GTGCAGTATTAGAAAAACAATGG - Intergenic
1032073871 7:128827044-128827066 TTGCAGAGCTAGAAGTAGAGAGG + Intergenic
1035440363 7:158892056-158892078 GTGCAGAGCTAGAACCACACTGG - Intronic
1035462668 7:159054022-159054044 GTGCAGTGGCAGAAGGCCAAAGG + Intronic
1037563422 8:20095440-20095462 TTACAGTTCTAGAAGTCCAAAGG - Intergenic
1039654409 8:39384849-39384871 ATGCAGTGAAAGAAGTACTAGGG - Intergenic
1040453426 8:47572234-47572256 GTGCTGGGCTATAAATACAATGG - Intronic
1041176185 8:55199158-55199180 GTACAGTGATAGAAGGTCAAAGG + Intronic
1042952024 8:74210333-74210355 GGGCTGTGCTAGAAAAACAAAGG + Intergenic
1043442661 8:80290080-80290102 GCGCATTGCTAAAAGAACAAAGG + Intergenic
1048794975 8:138141407-138141429 GTGCAGTGCTGGAAGCATCAGGG + Intronic
1049042556 8:140123626-140123648 GTGATGTGCGAGAAGTACATGGG - Intronic
1050096499 9:2072932-2072954 GTTAAGAGCTAGAAGTGCAAGGG - Intronic
1051763836 9:20500205-20500227 GTGCAGGGCTAGCAGGGCAAAGG + Intronic
1052118411 9:24677429-24677451 GTGCTGTGCTTGAAGGACTATGG - Intergenic
1052690853 9:31815241-31815263 GGGCAGTGCCAGAGGTGCAAGGG - Intergenic
1052984487 9:34476555-34476577 GAGCTGTGCTAGAAGAACAAGGG + Intronic
1060852397 9:126888662-126888684 CCGGAGTGCTAGAAGTAGAAGGG + Intergenic
1061591012 9:131597564-131597586 GTGCAGTGCTAGAAGTACAAAGG - Intronic
1187261163 X:17686512-17686534 GGGCAGTCCTAGAAGTAGAGGGG - Intronic
1188454220 X:30344098-30344120 TTGGAGTGCTAGAAGGAAAACGG + Intergenic
1188977295 X:36690820-36690842 GTGCAGTGCCAGCTGTAGAAGGG - Intergenic
1194149718 X:90309224-90309246 CTGCAATGCTAGAAGGACATGGG - Intergenic
1197752631 X:129976006-129976028 ATGCAGTGCTAGAAGTGGAAGGG - Intergenic
1200496096 Y:3885959-3885981 CTGCAATGCTAGAAGGACATGGG - Intergenic
1201414985 Y:13739579-13739601 GTCAAGAGCCAGAAGTACAATGG + Intergenic