ID: 1061591312

View in Genome Browser
Species Human (GRCh38)
Location 9:131599520-131599542
Sequence GTCTGGCCTCGTCTAAAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061591303_1061591312 7 Left 1061591303 9:131599490-131599512 CCAGAAGGGTACCATGAGCACAG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1061591312 9:131599520-131599542 GTCTGGCCTCGTCTAAAGGTCGG No data
1061591308_1061591312 -4 Left 1061591308 9:131599501-131599523 CCATGAGCACAGCCAGGGGGTCT 0: 1
1: 0
2: 1
3: 19
4: 294
Right 1061591312 9:131599520-131599542 GTCTGGCCTCGTCTAAAGGTCGG No data
1061591302_1061591312 8 Left 1061591302 9:131599489-131599511 CCCAGAAGGGTACCATGAGCACA 0: 1
1: 0
2: 2
3: 5
4: 128
Right 1061591312 9:131599520-131599542 GTCTGGCCTCGTCTAAAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061591312 Original CRISPR GTCTGGCCTCGTCTAAAGGT CGG Intronic
No off target data available for this crispr