ID: 1061591722

View in Genome Browser
Species Human (GRCh38)
Location 9:131602235-131602257
Sequence CTGTGGAGTGCAAGTTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061591716_1061591722 1 Left 1061591716 9:131602211-131602233 CCCAGCATTCCTGCCTGCAAGTG 0: 1
1: 1
2: 0
3: 19
4: 214
Right 1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 116
1061591717_1061591722 0 Left 1061591717 9:131602212-131602234 CCAGCATTCCTGCCTGCAAGTGG 0: 1
1: 1
2: 0
3: 32
4: 248
Right 1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 116
1061591720_1061591722 -8 Left 1061591720 9:131602220-131602242 CCTGCCTGCAAGTGGCTGTGGAG 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 116
1061591715_1061591722 24 Left 1061591715 9:131602188-131602210 CCTCTGCGGGGCTGCTCTGTCTT 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 116
1061591714_1061591722 25 Left 1061591714 9:131602187-131602209 CCCTCTGCGGGGCTGCTCTGTCT 0: 1
1: 0
2: 0
3: 38
4: 1458
Right 1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061591722 Original CRISPR CTGTGGAGTGCAAGTTCCTA TGG Intronic
901179189 1:7329011-7329033 TTTTGGAGTGCAAGGTCATAAGG - Intronic
902147480 1:14415675-14415697 CTGTGTTGTGCAGTTTCCTATGG + Intergenic
903548259 1:24140712-24140734 CTGTGGAGAGCAAGAGCCTGCGG + Intronic
905395761 1:37665419-37665441 ATGTCGAGTGCATGTTCCCAAGG - Intergenic
907716002 1:56926716-56926738 CTGCTGCGTGCAAGATCCTATGG + Intergenic
907880360 1:58544513-58544535 CTGTGCAGTTCAAATTTCTACGG + Intronic
912191017 1:107340639-107340661 CTGTGGTGTGTAATTTCCTCTGG - Intronic
913226656 1:116706475-116706497 CTGTGGAGCTCAGGTTCCTGTGG + Exonic
916824862 1:168433424-168433446 CTGTGGAGAGCTGGTTCCTTGGG + Intergenic
918373958 1:183889779-183889801 CTTTGGAGTGCAAGTAGCTGTGG - Intronic
920423072 1:205849212-205849234 CTGTTGAGTGCTAGATCCTATGG - Intronic
1063359679 10:5441347-5441369 CTGTGGGGAGCCAGTTGCTATGG + Intronic
1063574562 10:7250003-7250025 GTGTGGATTGTAAGTTCTTAAGG - Intronic
1070644225 10:78190357-78190379 CTGTGCAGTGGAACTCCCTAGGG - Intergenic
1071533912 10:86411785-86411807 CTGTGGCCTACAAGTTCCCAAGG - Intergenic
1075882768 10:125868501-125868523 CTGTAGACTGTAAATTCCTAAGG + Intronic
1076012173 10:126998228-126998250 CTGTGGAGTCCAAATTCATCAGG + Exonic
1078484029 11:11705476-11705498 CTGTTGAGTGCTTGTTCTTAGGG - Intergenic
1078623919 11:12935828-12935850 CAGTGGAATATAAGTTCCTAAGG - Intronic
1078840127 11:15070620-15070642 CTTTTGAGTGCCAGTTCCAAAGG + Intronic
1081878732 11:46429356-46429378 CTGTGGAGTTCGAGTTCCATCGG - Intronic
1081935198 11:46899291-46899313 CTGAGGAGTGCATGTACCAAGGG - Intronic
1083546643 11:63553783-63553805 CTGTGTAGTGAGAGTTCCCAGGG - Intronic
1085130240 11:74032085-74032107 CTGTGTAGTGCTAGGTCCTGAGG + Intronic
1085336226 11:75698624-75698646 CTGTTGACTGCAAATTCCTTTGG + Intergenic
1088670354 11:112134429-112134451 CTGTGAAGTGCTATTTTCTATGG + Intronic
1091091681 11:132776954-132776976 CTGTGGACCCCAAGTTCCTTTGG - Intronic
1096262219 12:50099977-50099999 CTGAGGAGTGAAAGCGCCTAGGG + Exonic
1099439364 12:82683040-82683062 CTTTGCAGTGCCAGTTCCTCAGG - Intergenic
1107655590 13:42589630-42589652 CCGTGGAGTACAAGTTGCGATGG - Intronic
1108800900 13:54093081-54093103 CTGAGGAATGCAAGTCCCTTGGG + Intergenic
1111513827 13:89300550-89300572 CTTTGGAGTGCCATTTCCTTTGG + Intergenic
1114265661 14:21071249-21071271 CTCTGCAGTGAAAGTTCCCAGGG - Intronic
1115804096 14:37031742-37031764 CTGTGGAATGATAGTTTCTAAGG - Intronic
1117255999 14:53978366-53978388 CTGTGGACAGCCAGTTCCAATGG - Intergenic
1117494929 14:56293726-56293748 CTGTGGAGGGAAAGTACCTTCGG - Intronic
1117518517 14:56527001-56527023 CTGTGGAGTGAGATTTTCTAGGG - Intronic
1118029870 14:61809391-61809413 GTGGGGAGTCCAAGTTCTTATGG + Intergenic
1118669676 14:68110220-68110242 CTGTGGCATTCAAGATCCTAGGG + Intronic
1118817918 14:69325761-69325783 CTGAGGAGTGCCTGTACCTATGG - Intronic
1119147721 14:72332084-72332106 CTGTTGAGCCCAAGTTCCTTAGG + Intronic
1122316990 14:100831700-100831722 CCTGGGTGTGCAAGTTCCTAGGG - Intergenic
1125259899 15:37811296-37811318 CTGTGCATTACAAGTTCCTGTGG - Intergenic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1134423264 16:14114024-14114046 CTATGGATTGCCAGTTCCTTTGG + Intronic
1144105123 17:11977360-11977382 CTTTGGAGTTCAACTGCCTAGGG + Intergenic
1144488535 17:15687426-15687448 CTCTGGAGTGCACCATCCTATGG - Intergenic
1144912477 17:18694879-18694901 CTCTGGAGTGCACCGTCCTATGG + Intergenic
1146476768 17:33169087-33169109 ATGTGGGGTGCAGGTTCCCAAGG - Intronic
1148458591 17:47824526-47824548 CAATGGAGAGCAAGTTACTAGGG - Intronic
1151003496 17:70405795-70405817 CTGTGGTTTGCAAATTCCTAGGG - Intergenic
1151023504 17:70648803-70648825 CTATGGAGTGGCAGTTCCTTGGG - Intergenic
1151228013 17:72661063-72661085 CAGTGGAGTGCAGGCTTCTAGGG + Intronic
1153286442 18:3459428-3459450 CTGTGGGGTGCAGCTTCGTAGGG + Intronic
1156072899 18:33235226-33235248 CTGTGGACTGGAACTTTCTAAGG + Intronic
1156849270 18:41707406-41707428 ATGTGGAGTCCAAGTTCCATTGG + Intergenic
1159175686 18:64830921-64830943 CTGTGGAGTAAAAGCTTCTACGG - Intergenic
1162131604 19:8529503-8529525 CTGTAGAGAGCATGTACCTATGG + Intronic
1164902244 19:31938186-31938208 CTGGGGAGTAGAGGTTCCTAAGG - Intergenic
1167963746 19:53127267-53127289 CTGGGGAGTGCAAGACCCCATGG - Intronic
925718457 2:6806460-6806482 CAGTTGAGTGTAAGTTCCTGGGG + Intergenic
927056515 2:19370398-19370420 CTGGGGAGGGCACCTTCCTAGGG - Intergenic
930769406 2:55116752-55116774 CTGTGGGGAGCAAGATTCTAGGG + Intergenic
934053824 2:88234952-88234974 CTCTGGATTGCAACTTCCCAGGG - Intergenic
942379343 2:175372020-175372042 CTATGGAAAGCAAGCTCCTATGG - Intergenic
942413586 2:175736124-175736146 CTGTGGAGTTCAAGTAGCTCTGG + Intergenic
946574675 2:221061845-221061867 CTGTGGAGTGCAAGTACCCCAGG - Intergenic
948765599 2:240217164-240217186 CTGTGGAGTTCATGCTCCTAAGG + Intergenic
1169657240 20:7938746-7938768 CAGGGGAATGTAAGTTCCTAGGG + Intronic
1170840697 20:19922700-19922722 CTGTGGAATGAAAGTGCCCATGG + Intronic
1171487362 20:25494469-25494491 CTGTGGAGTGCAAGGGCATGTGG - Intronic
1176235984 20:64053783-64053805 CTGTGGTGGGCATGTACCTAGGG + Intronic
1177793015 21:25740434-25740456 CTGTGGACTGAAAGTGCGTATGG + Intronic
1180858590 22:19063865-19063887 CTGTGGAGTGCCCTGTCCTATGG - Intronic
1183896171 22:40970987-40971009 CTGTAGAATGCAAGCTCCAAGGG - Intronic
949792189 3:7804948-7804970 CTGTGTAGTGAAAGCACCTAGGG + Intergenic
950650425 3:14403573-14403595 CTATGGAGTGCATGCACCTATGG - Intronic
952168434 3:30777392-30777414 ATGTAGAGTCCAAGTTCTTATGG - Intronic
952912619 3:38203846-38203868 CTGTGTTGTTCAAGGTCCTAGGG + Intronic
959194534 3:103162845-103162867 CTGGGAAGTGCAAGATCATAAGG + Intergenic
963042246 3:141078401-141078423 GTGGGGAGTGCAAGGTCCTTAGG + Intronic
963049462 3:141128673-141128695 ATGTGGAGTGGCAGTTCCAAAGG + Intronic
963239883 3:142992487-142992509 CAGTGGCATGCAAGTTCCTGTGG + Intronic
968454376 4:689502-689524 CTGTGGACCCCAAGTTCCTGAGG + Intergenic
973698501 4:53514166-53514188 CTATGGAATGCAAGTTCCAAAGG + Intronic
974728614 4:65831814-65831836 CTGTTGATTGCTATTTCCTAAGG + Intergenic
975812941 4:78188459-78188481 CTGTGGACTGCAAGGTCCAGTGG - Intronic
977477434 4:97530205-97530227 CAGAGGATTCCAAGTTCCTAGGG - Intronic
982287775 4:153753216-153753238 CTGTGGATTGCGGGCTCCTAGGG + Intronic
985053429 4:186015647-186015669 CTCTGGAATGCAAGTGCCTGCGG - Intergenic
987195207 5:15518956-15518978 CACCGGACTGCAAGTTCCTAGGG - Intronic
989193243 5:38691470-38691492 CTGTGGAGTGCTAGATCTTTAGG - Intergenic
990345083 5:54863952-54863974 CTGGAGAGTGTATGTTCCTAGGG + Intergenic
993430234 5:87823813-87823835 ATTTAGAATGCAAGTTCCTAAGG - Intergenic
995884438 5:116878038-116878060 CTATGGGCTGCAAGTTCTTATGG - Intergenic
997707068 5:135965751-135965773 CTGTGCTGAGCAAGATCCTAGGG - Intergenic
999332766 5:150688336-150688358 CTGTGGAGTGCAATTCTCCAGGG - Intergenic
1002776283 6:330260-330282 AGGGGGAGAGCAAGTTCCTAAGG - Intronic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1005793148 6:29328172-29328194 CTGTAGAGAGCAGGTTTCTATGG - Intergenic
1010593525 6:77737472-77737494 TTGAGGAGTGCACGTTCCTAAGG + Intronic
1011526733 6:88273489-88273511 CTGTTGAGTGCCAGACCCTAGGG + Intergenic
1012868415 6:104645031-104645053 CTGTGGAGTTCATTTTCCAAGGG - Intergenic
1013770409 6:113622076-113622098 CTGAGGAGTGCAAATGGCTAAGG - Intergenic
1015198487 6:130551761-130551783 CTGTGGATGGCAAGATCCCATGG - Intergenic
1016769472 6:147832731-147832753 CTCTAGACTGTAAGTTCCTATGG + Intergenic
1020642774 7:10777403-10777425 CTTTGGACTTCAAGATCCTAAGG - Intergenic
1022510280 7:30930954-30930976 CTGGGAAGAGCAAGTTCCTGGGG + Intergenic
1023129694 7:36990372-36990394 CTGTGGAGTACAAGTCCATTAGG - Intronic
1023324104 7:39033714-39033736 CTGTGGTGTGTAAGTTTCAAGGG - Intronic
1027839912 7:83296391-83296413 CTGGGGAGGGCAAGATTCTATGG - Intergenic
1029502939 7:100945062-100945084 CTGTGTAGTCCCAGTTACTAGGG - Intergenic
1045412442 8:101932207-101932229 CTGTGGACTGCAAGTCCCTGTGG - Intronic
1049905286 9:211044-211066 CAGTGGAATGCAAGATCCTGAGG - Intergenic
1050596935 9:7213467-7213489 CTGTGGAGTGCATGTTGCATGGG + Intergenic
1052975649 9:34408052-34408074 CAGTGGTTTGCAAGTTCCTGAGG + Intronic
1055581564 9:77711650-77711672 CTGGGGAGACCAAGTTCCTGGGG + Intergenic
1057858950 9:98624700-98624722 CTGTGCAGGCCAAGTTCCTTAGG - Intronic
1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG + Intronic
1062729204 9:138099623-138099645 CTGTGGTGTGCATGTGCCTGTGG + Intronic
1062729206 9:138099640-138099662 CTGTGGTGTGCATGTGCCTGTGG + Intronic
1195949354 X:110251190-110251212 CTGTGGAGCGCAATTTCAAAAGG + Intronic
1199167585 X:144695585-144695607 CTGTGGATTGTAAATTTCTATGG - Intergenic
1200352003 X:155507015-155507037 CTGAGGAGTTCAAATTCCTCAGG + Exonic