ID: 1061593529

View in Genome Browser
Species Human (GRCh38)
Location 9:131614093-131614115
Sequence CTCCCTTTGCACGGTCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061593529_1061593534 15 Left 1061593529 9:131614093-131614115 CCATGTGGACCGTGCAAAGGGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1061593534 9:131614131-131614153 TGCACCAACACCCCCCCCCAAGG No data
1061593529_1061593537 19 Left 1061593529 9:131614093-131614115 CCATGTGGACCGTGCAAAGGGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1061593537 9:131614135-131614157 CCAACACCCCCCCCCAAGGAGGG No data
1061593529_1061593535 18 Left 1061593529 9:131614093-131614115 CCATGTGGACCGTGCAAAGGGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1061593535 9:131614134-131614156 ACCAACACCCCCCCCCAAGGAGG No data
1061593529_1061593538 20 Left 1061593529 9:131614093-131614115 CCATGTGGACCGTGCAAAGGGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061593529 Original CRISPR CTCCCTTTGCACGGTCCACA TGG (reversed) Intronic
900697385 1:4020759-4020781 CTGCCCTTGCACTGTCCACAAGG - Intergenic
900799513 1:4728616-4728638 CTGCCTTTCCACGGAGCACAGGG - Intronic
901760721 1:11469455-11469477 CTCACTTTGCAGGGTTCCCACGG - Intergenic
901878622 1:12181176-12181198 CCTCCTTTGCAAGGCCCACACGG + Intronic
903373868 1:22853767-22853789 CTCCCCTTCCACGGTCCACCTGG - Intronic
904344749 1:29860515-29860537 ATCCCTTTGCTCTTTCCACAGGG + Intergenic
904600812 1:31671649-31671671 CTTCCTTTGCAGGGTCCGCCTGG - Exonic
905827817 1:41039811-41039833 CTCCCTGTGGAGGTTCCACAGGG - Intronic
907719212 1:56955800-56955822 ATCCCCATGCACAGTCCACATGG + Intronic
909985287 1:82154330-82154352 CTGCCTTTGTCCGCTCCACATGG - Intergenic
915918949 1:159959830-159959852 CTCCCATTGTACGTTCCTCAAGG + Intergenic
916424901 1:164670874-164670896 CTGCCTTTGCAAAGTGCACACGG - Intronic
919570720 1:199243707-199243729 CTGCCTTTGCTCGGCCCCCATGG - Intergenic
920502348 1:206493292-206493314 CCCCCTTTGCTCGGTCCTGAAGG - Exonic
923517100 1:234707105-234707127 CTCCCTTTTAAAGCTCCACAAGG - Intergenic
923567978 1:235091041-235091063 CTCGATTCCCACGGTCCACATGG + Intergenic
1063662801 10:8045554-8045576 CTCCCTCTGCCCGCTCCACGTGG + Intergenic
1065294324 10:24259975-24259997 CTCCCTTTGCAATTTCCCCATGG + Intronic
1069906238 10:71734260-71734282 CGCCCTTCTCACGGTCCACCAGG - Intronic
1075261121 10:120964532-120964554 CTCTCTGTGCATGGACCACATGG - Intergenic
1083365543 11:62139670-62139692 CTCCCGCTGCAGGGTCAACATGG - Intronic
1086549861 11:88043258-88043280 CTACTTTTGCAAAGTCCACAGGG + Intergenic
1087035799 11:93755272-93755294 CTCCATCTGCAGGGTTCACATGG - Exonic
1101995869 12:109524526-109524548 CTCCCTTTCCACTGCCCCCATGG + Intronic
1102799584 12:115719795-115719817 CTCCCTGTGTAGGTTCCACATGG - Intergenic
1106057659 13:26253972-26253994 CTCCCTCCACACGGTCCTCAGGG + Intergenic
1106059014 13:26267894-26267916 CTCCCTTTGCTAAATCCACAGGG + Intronic
1112044973 13:95587459-95587481 CTCCCAGTGCTCGGTACACACGG + Intronic
1117096160 14:52300477-52300499 TTCGCTTTGGACGGTCCTCAGGG + Intergenic
1121321155 14:92992391-92992413 CTCCCTTTGCACTGTCTTCCTGG - Intronic
1122340096 14:101022381-101022403 CTCCTTTCGCACAGGCCACATGG - Intergenic
1122506284 14:102233857-102233879 CTCCCCTTGTGCGGTCCAGATGG - Intronic
1122518549 14:102326251-102326273 CTCTCTTTGCAGGGACCACCTGG - Exonic
1123068587 14:105630198-105630220 CTTCCTGTGCAGGGTCCACTCGG - Intergenic
1123072587 14:105648999-105649021 CTTCCTGTGCAGGGTCCACTCGG - Intergenic
1123092610 14:105748525-105748547 CTTCCTGTGCAGGGTCCACTTGG - Intergenic
1123098170 14:105776226-105776248 CTTCCTGTGCAGGGTCCACTCGG - Intergenic
1127774424 15:62254175-62254197 GTCATTTTGCACGGTCCCCAGGG + Intergenic
1128658947 15:69483793-69483815 TTCCCTTTGCACTGCGCACAGGG - Intergenic
1130137901 15:81197115-81197137 CTCCCTATGCACAGTCCCCCGGG - Intronic
1130179150 15:81607393-81607415 CTCCCTGTGCCCTCTCCACATGG - Intergenic
1132812716 16:1809313-1809335 CTCCCTGCGCACGGCCCGCATGG + Exonic
1133741985 16:8658809-8658831 ATCCCTTTGCAGGGCCCACAAGG + Intergenic
1135969390 16:27061324-27061346 AGCCCTTTCCACGGCCCACAGGG + Intergenic
1139661822 16:68425946-68425968 CTCCCTTAGCATCCTCCACATGG - Intronic
1141588055 16:85048212-85048234 CTCCCTCTGCAAGGTGCACATGG - Intronic
1142261451 16:89044340-89044362 CTTTCTTTGCAAGGACCACATGG - Intergenic
1143368056 17:6421244-6421266 CTGCCTTTGAAGGGGCCACAAGG + Intronic
1144994777 17:19260040-19260062 CTCCAGTGGCACAGTCCACAGGG - Intronic
1149756484 17:59190741-59190763 CTCCCTTTGCACTAGCAACATGG + Intronic
1152843936 17:82587788-82587810 CACCCTTTCCACACTCCACAGGG - Intronic
1152874586 17:82779480-82779502 CTCCCTAAGCATGCTCCACAGGG + Intronic
1153582644 18:6590576-6590598 CTCCATTTGCAGGATCCACACGG - Exonic
1157110096 18:44812575-44812597 TCCCTTTTGCACTGTCCACATGG - Intronic
1162105818 19:8369023-8369045 CTTCCTCAGCATGGTCCACAAGG - Intronic
1164079549 19:21850721-21850743 TTGCCTTGGCACTGTCCACAAGG - Intronic
1164083083 19:21877543-21877565 CTGCCTTGGCACTGTGCACAGGG + Intergenic
1164191063 19:22917656-22917678 CTGCCTTGGCACTGTGCACAGGG + Intergenic
1164257526 19:23541992-23542014 TTCCCTTGGCACTGCCCACATGG - Intronic
1165704563 19:37966537-37966559 CTCCCTCTGCACCGTCCATCTGG + Intronic
929827721 2:45322370-45322392 CTCCCTTTCCCGTGTCCACAGGG - Intergenic
930384187 2:50672809-50672831 CTCCCATTGCAGGGACCTCATGG - Intronic
946696994 2:222369609-222369631 CTCCCTTGGTACTGTCCTCATGG - Intergenic
1174448690 20:50607276-50607298 TTCCCTGTGCATGTTCCACATGG - Intronic
1174505449 20:51014873-51014895 CTCCCTCTGCCAGGTCCTCACGG - Intronic
1174551892 20:51368151-51368173 CTCCCTCTGAAAGCTCCACAGGG + Intergenic
949105365 3:196707-196729 CTCCCTTTGCACGCTCCCGCGGG - Exonic
950558965 3:13711075-13711097 CTACCTTTGCAGCGGCCACAAGG + Intergenic
950559694 3:13714438-13714460 CTACCGTTGCAGGGGCCACATGG + Intergenic
950575658 3:13830637-13830659 CTCCCTGTCCATGGACCACATGG + Intronic
953143163 3:40248245-40248267 CACCCTTAGCATGCTCCACAAGG - Intronic
955817439 3:62860489-62860511 CTTCCTATGCAGGTTCCACAGGG - Intronic
956173171 3:66449145-66449167 TGTCCTTTGCACGGTCCACTTGG + Intronic
963631154 3:147731747-147731769 ATCCCTTTACACTGTCTACATGG + Intergenic
969488493 4:7485660-7485682 CACCCTCTGCTGGGTCCACACGG - Intronic
972384287 4:38549095-38549117 CTCCCTTTGCACCTTAAACAGGG - Intergenic
974077904 4:57184472-57184494 CTCCCCGTGCAGGGTCCAGAAGG - Intergenic
974242309 4:59266077-59266099 CTCCCTTTGTACGCTCCAGAGGG + Intergenic
974378054 4:61103177-61103199 CTCCCTTTGCATCACCCACAAGG - Intergenic
976009953 4:80475111-80475133 CTCCCTCTGCCCGAGCCACATGG - Intronic
976961855 4:90986855-90986877 CTACCTTTGCATGATACACAGGG - Intronic
978752494 4:112267003-112267025 CTGGCTTTGGACTGTCCACAAGG - Intronic
980891222 4:138817910-138817932 CTCCCTTTTAATGTTCCACAGGG - Intergenic
983780392 4:171663278-171663300 CTCCCTTTGCTAGCTGCACAAGG - Intergenic
984570298 4:181383851-181383873 CTCACTTGGCTCGGGCCACATGG + Intergenic
984841299 4:184070135-184070157 CCCCCTTAGCACTGTCCTCAGGG + Intergenic
984919898 4:184754434-184754456 CTCCCTTAGCACTGAACACAGGG - Intergenic
986073141 5:4307250-4307272 CTCCCATGGCTCTGTCCACACGG + Intergenic
994669644 5:102751719-102751741 CTCCCTTTTCACTCTCCTCAGGG - Intergenic
998772827 5:145565757-145565779 CTTCCTTTGCAGGCTCCTCATGG + Intronic
1003118012 6:3296188-3296210 CTCGTTTTGGACGGTCCAGATGG - Intronic
1005304184 6:24497692-24497714 TCCCCTTTGCTCAGTCCACACGG - Intronic
1008768388 6:54948238-54948260 GTCCCTTTGAAAGGGCCACAAGG + Intergenic
1009770926 6:68141989-68142011 CTCCCTTTGTTCAGTCCACCAGG + Intergenic
1009977217 6:70683998-70684020 CTCCCTTCTCACTGTGCACAAGG - Intronic
1011279634 6:85663824-85663846 CTTCCATTGCACAGTCTACAGGG - Intergenic
1016019460 6:139220460-139220482 CTCCCTTTGGATGGTATACAAGG - Intergenic
1018978352 6:168582639-168582661 CTTTCTTTGGACGGTCCACCTGG + Intronic
1035764233 8:2092581-2092603 CTCCCTGTGCCAGGGCCACAGGG - Intronic
1049191046 8:141287827-141287849 CTCCCAGGGCACAGTCCACAGGG + Intronic
1054949487 9:70834339-70834361 CTCCCTTTGCCCAGTCCTGAGGG + Intronic
1055470332 9:76604293-76604315 CTGCCTTTGAATGGACCACAGGG + Intergenic
1055944332 9:81679324-81679346 CTTCCTGAGCAGGGTCCACAGGG - Intronic
1056026522 9:82502864-82502886 CTCCCTTAGCAAGCTTCACAAGG + Intergenic
1056271426 9:84951650-84951672 CTCCCTTGGCACCTTGCACAGGG + Intronic
1056494901 9:87146946-87146968 CTCCCTTTGTACCTTCCACTTGG - Intergenic
1058769686 9:108218111-108218133 CTCCCTTTGCACATGACACAAGG + Intergenic
1061593529 9:131614093-131614115 CTCCCTTTGCACGGTCCACATGG - Intronic
1187463173 X:19505559-19505581 ATCCCTTTCCATGGTCCCCATGG - Intronic
1189409105 X:40754588-40754610 CCCCCTTTGTACCGTCCTCATGG - Intergenic
1199568916 X:149247306-149247328 ATCCCCTGGCAGGGTCCACATGG - Intergenic
1201742304 Y:17337074-17337096 CTCTCTTTGTTCAGTCCACAAGG + Intergenic