ID: 1061593532

View in Genome Browser
Species Human (GRCh38)
Location 9:131614102-131614124
Sequence GGTCTGACCCTCCCTTTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061593532_1061593537 10 Left 1061593532 9:131614102-131614124 CCGTGCAAAGGGAGGGTCAGACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1061593537 9:131614135-131614157 CCAACACCCCCCCCCAAGGAGGG No data
1061593532_1061593535 9 Left 1061593532 9:131614102-131614124 CCGTGCAAAGGGAGGGTCAGACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1061593535 9:131614134-131614156 ACCAACACCCCCCCCCAAGGAGG No data
1061593532_1061593538 11 Left 1061593532 9:131614102-131614124 CCGTGCAAAGGGAGGGTCAGACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data
1061593532_1061593534 6 Left 1061593532 9:131614102-131614124 CCGTGCAAAGGGAGGGTCAGACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1061593534 9:131614131-131614153 TGCACCAACACCCCCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061593532 Original CRISPR GGTCTGACCCTCCCTTTGCA CGG (reversed) Intronic
900009710 1:95079-95101 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
900025822 1:271663-271685 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
900035605 1:405519-405541 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
900057225 1:641269-641291 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
900601403 1:3504266-3504288 GGTCGGAGCCTCCCTTGGCATGG - Intronic
901762748 1:11481168-11481190 GGTCTGACCCAGTCTTTGCTGGG + Intronic
909088774 1:71199848-71199870 GTTCTTACCCTCCATTTGCATGG + Intergenic
912691967 1:111811475-111811497 GGTCTGTCCCTCCCTTACCTGGG + Intronic
921293488 1:213680491-213680513 GTTCTGACAGTCCTTTTGCAAGG - Intergenic
921432965 1:215083696-215083718 GGGCTGACCCTCCTTCTCCATGG - Intronic
922258142 1:223911084-223911106 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
922465395 1:225842970-225842992 GCTCTGACCCACCCTTTCCAGGG + Intronic
924339333 1:243013849-243013871 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
1062928854 10:1339225-1339247 GATTTGACCCACCCTTTCCATGG - Intronic
1064507774 10:16051762-16051784 GGTATGATCCTCCTTTTACAAGG - Intergenic
1068191602 10:53659644-53659666 GTCCGGACCCTCCCTTTGTATGG + Intergenic
1069502400 10:68965821-68965843 GGTCTGTCCCTCTTTCTGCATGG + Intronic
1070776377 10:79112282-79112304 GGTCGGACCCACGCTCTGCACGG + Intronic
1072862422 10:99020500-99020522 GATCTGACATTCCCTTTCCAAGG + Intronic
1076097699 10:127745266-127745288 TGACTGAACCTCCCTTTGCTGGG + Intergenic
1078459623 11:11504225-11504247 GCTCTGATCCTGCCTTTGCTGGG - Intronic
1079101913 11:17547293-17547315 GGTGTGACCCTGCCTTAGCCCGG + Intergenic
1082017277 11:47499731-47499753 GGGCTGAGCCTCCCTTCACATGG - Intronic
1083630437 11:64092405-64092427 GCTCTGACCCTGCCTATGGAGGG + Intronic
1084303442 11:68266070-68266092 GGTCTCCCACTCCCCTTGCATGG - Intronic
1085181023 11:74536106-74536128 GGTCTGAACCTACCACTGCAGGG - Intronic
1087665936 11:101047750-101047772 GGGCTGATCCTGCCTATGCAAGG + Intronic
1088811575 11:113396046-113396068 AGCCTGAGCCTCCCTTTGCAGGG + Exonic
1089347245 11:117798177-117798199 GGACTGTAGCTCCCTTTGCAGGG + Intronic
1090636248 11:128692304-128692326 GGTCAGTCCCCCCCTTTGCCTGG - Intronic
1093103643 12:15058765-15058787 TGTCTGCCCCTCCCTTCCCATGG + Intergenic
1096465755 12:51847223-51847245 GGTCTGGGACTCCCTCTGCAGGG + Intergenic
1102238971 12:111311989-111312011 GGTCTGACCCTCACTCTTCTGGG + Intronic
1105437310 13:20390263-20390285 GGGCTGCCCCTCCCTCCGCAGGG + Intergenic
1105437863 13:20392152-20392174 GGACTGCCCCTGCCTTTGCGCGG - Intergenic
1108596584 13:51955087-51955109 CCTCTGACCATCCCTTTGCTGGG - Intronic
1111186461 13:84743027-84743049 AGTTTGAGCCTACCTTTGCAAGG + Intergenic
1112975738 13:105315042-105315064 TGACAGACCCTCCCTTTGAAAGG + Intergenic
1113075890 13:106467903-106467925 TCTCTGACCTGCCCTTTGCATGG + Intergenic
1114069343 14:19095448-19095470 TCGGTGACCCTCCCTTTGCAAGG - Intergenic
1114092918 14:19304554-19304576 TCGGTGACCCTCCCTTTGCAAGG + Intergenic
1118608700 14:67522789-67522811 GGTTTGCCCCACCCTCTGCAAGG - Intronic
1122291489 14:100682619-100682641 GGCCAGTCTCTCCCTTTGCAAGG + Intergenic
1122604209 14:102937708-102937730 TGTCTGCCCCTCCCTTGGGATGG - Intronic
1122740717 14:103870217-103870239 GGCCTGAGACTCCCTCTGCAGGG - Intergenic
1125415587 15:39448780-39448802 GGTGTAAGCCTCCCTCTGCAAGG - Intergenic
1126111616 15:45178466-45178488 GCTCTGGCTCTTCCTTTGCAGGG + Intronic
1128391769 15:67187181-67187203 GGGTTGGCCTTCCCTTTGCATGG + Intronic
1130632215 15:85580746-85580768 GGCCTTACCCACACTTTGCAGGG - Exonic
1132243391 15:100277014-100277036 GGTGTGAGCCCCCCTGTGCAAGG + Intronic
1134902054 16:17947345-17947367 TGTCTGACATTCCCTTTGTAAGG + Intergenic
1139838658 16:69860588-69860610 GGTCTGACTCTCCCTTGGTAGGG + Intronic
1140485206 16:75288094-75288116 CTTCTGACCCACTCTTTGCAGGG - Intergenic
1141805501 16:86338831-86338853 GGTCCTACCCTCTCTTTGCAGGG - Intergenic
1142454619 16:90211826-90211848 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1144866217 17:18337582-18337604 GGTCTCCCTCTCCCTTTCCACGG + Intronic
1145431780 17:22978429-22978451 GGGCTGAACATTCCTTTGCATGG + Intergenic
1145442457 17:23125953-23125975 GGGCTGAACATTCCTTTGCATGG + Intergenic
1151920177 17:77148683-77148705 CGTAAGCCCCTCCCTTTGCAGGG + Intronic
1152287338 17:79420737-79420759 GGCCTGACCCTCCTGTGGCAGGG - Intronic
1152385349 17:79970859-79970881 GGGCTGACTCTCCGTTTCCAGGG - Intronic
1156445713 18:37235370-37235392 GGCCTGGCCCACTCTTTGCAGGG - Intergenic
1157817747 18:50742339-50742361 AGGCTGACCCTGCCTTGGCAGGG + Intergenic
1158956645 18:62546571-62546593 GGTCTGAACCCCCCTTTTCAAGG - Intronic
1162393619 19:10404030-10404052 GGTATGGCCCTCCCCTTGCAGGG + Intronic
1163034030 19:14561391-14561413 GATCTGACCCACCCTATGCAGGG - Intronic
1163468258 19:17482158-17482180 GGTCTGTCCCTCCCTATACTGGG - Intronic
1164800979 19:31076375-31076397 GTGCTAACCTTCCCTTTGCAGGG + Intergenic
1165309701 19:35022716-35022738 GGCCTGACCCTCACCTCGCAGGG - Intronic
1167203821 19:48086465-48086487 GCTCTAACTCTCCCTGTGCAGGG - Intronic
1168254737 19:55159192-55159214 GGCCTGACCCAGCCTCTGCAGGG - Exonic
926118190 2:10226387-10226409 GCTCTTCGCCTCCCTTTGCAGGG + Intergenic
932830547 2:74985517-74985539 AGTCTGAGCCTCCCATTGGATGG + Intergenic
936879484 2:117232770-117232792 GCTCTGACACTCCATGTGCAAGG + Intergenic
941366441 2:164617223-164617245 GGGCTGTCCCTACCTTTGAAGGG - Intronic
942779342 2:179622849-179622871 GGCATGTCCCTCCCTTTGCTAGG - Intronic
944602801 2:201320681-201320703 GCTCTGAGTCTCCCTGTGCAGGG - Intronic
948095091 2:235327193-235327215 GTTCAGAGGCTCCCTTTGCAAGG - Intergenic
948518077 2:238518721-238518743 GTTCCGACCCTCCGTTTGCCTGG - Intergenic
949086078 2:242156480-242156502 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1170435542 20:16324296-16324318 TGTCTGAACCTCCCTCTCCATGG - Intronic
1172922125 20:38492960-38492982 GGACTGACCCTTCCATTGGATGG + Exonic
1174104680 20:48153765-48153787 AGGCTGACTTTCCCTTTGCAGGG - Intergenic
1175669368 20:60888862-60888884 GATTTGATCCTGCCTTTGCAGGG + Intergenic
1176059676 20:63167053-63167075 GGTCTCACCGGCCCTGTGCATGG - Intergenic
1179114583 21:38478348-38478370 GGACTGACTCTCACATTGCAGGG + Intronic
1179565202 21:42243243-42243265 CGTCGGCCCCTCCCTCTGCAGGG + Intronic
1179785384 21:43727096-43727118 GATCCGCCCCTCCCTTTCCAGGG - Intronic
1180043767 21:45293501-45293523 GGCCTGCTCCTCCGTTTGCAAGG + Intergenic
1180058072 21:45369315-45369337 GGTCTGTCCCTGCCTCTGCCAGG + Intergenic
1180487814 22:15818011-15818033 TCGGTGACCCTCCCTTTGCAAGG - Intergenic
1182433479 22:30315027-30315049 GGCCTGACCTTCCCTTTCCTTGG - Intronic
1182792393 22:32963925-32963947 GGCCTGAACCTCCCCTTGCTGGG - Intronic
1184167075 22:42735926-42735948 GTTCTGCCCCTCCCGATGCAGGG + Intergenic
1184875374 22:47271020-47271042 GGTCGCACCCTGGCTTTGCACGG - Intergenic
950097239 3:10337406-10337428 CTTCTGACCCTCCCCTCGCAGGG + Intronic
961017264 3:123478031-123478053 TGTCTGCCCCTCCCTTCACATGG - Intergenic
962891414 3:139676358-139676380 GGTCTGACACGTCCTTAGCAAGG + Intronic
967108457 3:186272423-186272445 GGTCTGTACCTCCCTTTGGGTGG + Intronic
968193383 3:196687355-196687377 GGACTGACCCTCTCACTGCAAGG - Intronic
970082086 4:12298999-12299021 GGTCTGCCTCTCCCATTCCAAGG + Intergenic
972375141 4:38462814-38462836 GGTCAGAATCTCCCTGTGCAGGG - Intergenic
979237789 4:118421380-118421402 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
991389040 5:66122760-66122782 GGTCTGACAATTCTTTTGCAAGG - Intergenic
998407601 5:141882898-141882920 GGTCCCACCCTCAGTTTGCATGG - Intergenic
1002738216 5:181413345-181413367 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1003735476 6:8873333-8873355 GTTCTGACCCTGCCGTTTCATGG - Intergenic
1004219179 6:13730920-13730942 GGGCTGACCTCCCCCTTGCATGG + Intergenic
1007056398 6:38890059-38890081 GGTCAGACCATCACTTTGCTGGG + Intronic
1009737159 6:67690956-67690978 GGTGGGACCCTTCCCTTGCATGG - Intergenic
1010318440 6:74477902-74477924 GGTCTGACTTTTCATTTGCATGG - Intergenic
1014752684 6:125271867-125271889 GGTCTGTCCCTGCCCATGCAAGG + Intronic
1017961031 6:159220805-159220827 AGGCTGGCCCTCCCTGTGCACGG + Intronic
1019243316 6:170688904-170688926 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1019777580 7:2921819-2921841 GGCCTCACCCTCCCTTTTCACGG - Intronic
1019911347 7:4102240-4102262 CATCTGTCCCTCCCTCTGCAGGG + Intronic
1021491428 7:21223454-21223476 GGTCAGACACTTCCTTTACAGGG - Intergenic
1021668910 7:23015101-23015123 AATCTGATCCTCCCTTTGGAGGG - Intergenic
1022420958 7:30222962-30222984 GGGCTTTCCCTCCCTTTGCTGGG - Intergenic
1023046320 7:36213622-36213644 GGCCTGACGCTTCCTTTGCCAGG - Intronic
1024063502 7:45715613-45715635 GATCAGCCCCTCCCTGTGCAGGG - Exonic
1025230480 7:57200790-57200812 GGTAGGACCCTCCCTCAGCAGGG - Intergenic
1029477632 7:100794368-100794390 TGTCTGTCCCTGCCTTTGTAGGG + Intronic
1032709742 7:134451321-134451343 GGATTGGCCCTCCCTTTCCAGGG - Intronic
1035031261 7:155862624-155862646 GGGCTGACCCTGACTTTGGAGGG + Intergenic
1035504806 8:119259-119281 GGTCTGCATGTCCCTTTGCAAGG - Intergenic
1037235484 8:16715064-16715086 GTTCTGAGCCTCTCTCTGCAAGG + Intergenic
1037861993 8:22412011-22412033 GGGCTGGCCCTCCCTCCGCACGG + Intronic
1038049810 8:23797985-23798007 GTTCTGACACTCCCTTTGCATGG - Intergenic
1042836332 8:73081896-73081918 GGCCTGACACTGCCTTTTCATGG - Intronic
1047756110 8:127919642-127919664 TGTCTGACCTTCCCTCTGCCTGG + Intergenic
1048438304 8:134438866-134438888 GGTTTAAACCTCCCTTTGCATGG + Intergenic
1049417052 8:142500044-142500066 TGTCTGAGCCTCCCTCAGCACGG + Intronic
1049798744 8:144508201-144508223 GGTGGGCCCCTCCCTTGGCAGGG + Intergenic
1053298729 9:36933848-36933870 GGCCAGACCCTCCCCTTGCCAGG + Intronic
1061408350 9:130404934-130404956 GGACTGCCCCTCGCCTTGCAAGG - Intronic
1061593532 9:131614102-131614124 GGTCTGACCCTCCCTTTGCACGG - Intronic
1062618191 9:137407457-137407479 GGCCAGACCTGCCCTTTGCACGG - Intronic
1062635525 9:137488643-137488665 GGTCTGTCCCTCCCTCCCCATGG + Intronic
1203603505 Un_KI270748v1:38128-38150 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1186115442 X:6300745-6300767 AGTCTTACCTTCCATTTGCATGG - Intergenic
1189336446 X:40173423-40173445 GATCTGGCACTCCCTTTGGATGG + Intronic
1198090215 X:133321379-133321401 GGTGTTAGCCTCACTTTGCAAGG - Intronic
1202385570 Y:24323182-24323204 GGTCTGCATGTCCCTTTGCAAGG + Intergenic
1202485216 Y:25346946-25346968 GGTCTGCATGTCCCTTTGCAAGG - Intergenic