ID: 1061593533

View in Genome Browser
Species Human (GRCh38)
Location 9:131614123-131614145
Sequence GGGGGTGTTGGTGCACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061593533_1061593553 29 Left 1061593533 9:131614123-131614145 CCAGTGTGTGCACCAACACCCCC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1061593553 9:131614175-131614197 CTCTCCCACCCCCGGCTACCGGG No data
1061593533_1061593538 -10 Left 1061593533 9:131614123-131614145 CCAGTGTGTGCACCAACACCCCC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data
1061593533_1061593552 28 Left 1061593533 9:131614123-131614145 CCAGTGTGTGCACCAACACCCCC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1061593552 9:131614174-131614196 CCTCTCCCACCCCCGGCTACCGG No data
1061593533_1061593548 21 Left 1061593533 9:131614123-131614145 CCAGTGTGTGCACCAACACCCCC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1061593548 9:131614167-131614189 AGAAACCCCTCTCCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061593533 Original CRISPR GGGGGTGTTGGTGCACACAC TGG (reversed) Intronic
900376700 1:2358112-2358134 GTGTGGGTTTGTGCACACACTGG + Intronic
900441724 1:2658967-2658989 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900441951 1:2660130-2660152 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900442617 1:2663583-2663605 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900442844 1:2664746-2664768 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900443510 1:2668199-2668221 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900443737 1:2669362-2669384 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900444265 1:2672132-2672154 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900444513 1:2673377-2673399 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900444739 1:2674540-2674562 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900445879 1:2680522-2680544 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900446121 1:2681766-2681788 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900446398 1:2683212-2683234 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900446610 1:2684297-2684319 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900446885 1:2685700-2685722 GGGGGTGTGGGTGCGGACCCAGG - Intronic
900448387 1:2693167-2693189 GGGGGTGTGGGTGCGGACCCAGG - Intronic
900450077 1:2701561-2701583 GGGGGTGTGGGTGCTGACCCAGG - Intronic
900451091 1:2750185-2750207 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900451325 1:2751348-2751370 GGGGGTGTGGGTGCCGACCCAGG - Intronic
900451861 1:2754119-2754141 GGGGGTGTGGGTGCGGACCCAGG - Intronic
903143481 1:21354725-21354747 GGGGCTGTGGGGGCACAGACGGG - Intergenic
903914424 1:26753195-26753217 GGGGGTGCTGGTACTCTCACAGG - Intronic
904058416 1:27687240-27687262 GGTGTTCTTGGTGTACACACGGG + Intergenic
904914627 1:33960953-33960975 GGGGTTGTCTGTGCCCACACAGG - Intronic
906164271 1:43674228-43674250 GGGGGCGGTGGGGCACACAGTGG - Intronic
907424279 1:54369307-54369329 GGGGGTGGGGGGGCACAAACTGG + Intronic
912383958 1:109262187-109262209 GGGCATGTGGGTGCACACAGAGG + Intronic
912486799 1:110035147-110035169 GGGGGTCTTGGTGCACTCCAGGG + Intronic
912518236 1:110228939-110228961 TGGGCTGTAGGTGCACACCCCGG + Intronic
914681464 1:149941433-149941455 GGGGGTGGAGGCGCACACAGTGG + Exonic
916532167 1:165667489-165667511 GGGGGTGGTGGTGCACACTGTGG - Intronic
920230446 1:204466484-204466506 GGGGGTGGGGGTGCACAGAGGGG + Intronic
920654787 1:207867425-207867447 GGGGGAGTAGGTTCACCCACAGG + Intergenic
923008114 1:230067729-230067751 GGGGGTGTTGGGAAACACAAAGG + Intronic
923373105 1:233332320-233332342 GGGGGTGCTGTTTCACACAGGGG + Intronic
923407635 1:233678604-233678626 GGCTGTGGTGGTGCACACTCAGG + Intergenic
1062802351 10:389486-389508 GGGAGGGTGGGTGGACACACAGG + Intronic
1069628197 10:69881029-69881051 GAGGGTGCTAGTGAACACACAGG - Intronic
1072157763 10:92739301-92739323 GGGCATGTTGGTGCACACCTGGG + Intergenic
1072191734 10:93081511-93081533 GGGGTGGTTGGAGCAGACACAGG - Intergenic
1073116315 10:101093782-101093804 GGGTGGGTGGGTGAACACACAGG - Intronic
1073431553 10:103490713-103490735 GGTGTTGTGAGTGCACACACAGG - Intergenic
1074476962 10:113782133-113782155 GGGGGTGTTAGAGCAAAAACAGG + Intronic
1074884773 10:117685097-117685119 GGGGGCGCTGGCACACACACCGG + Intergenic
1076789479 10:132769054-132769076 CGGGGCGTTGGTGCGTACACTGG + Intronic
1077023764 11:430842-430864 GGGGGTGTGGGGGCTCACGCGGG + Intronic
1077061270 11:618879-618901 GGAGGTGCTGGTTCCCACACCGG + Exonic
1078904989 11:15675564-15675586 CTGGGTGGTGCTGCACACACAGG + Intergenic
1079085867 11:17444459-17444481 GGTGGTGTGGGTGCAGACACCGG - Intronic
1083887784 11:65581249-65581271 GGGGGTGCAGGAGCACTCACAGG - Exonic
1084477288 11:69396157-69396179 GGGGGTGATGGTGCCCCCAGGGG + Intergenic
1089021073 11:115215486-115215508 GGAGCTGCAGGTGCACACACAGG - Intronic
1091135080 11:133181167-133181189 GGGTGTGTTTGTGAACACACGGG + Intronic
1091303424 11:134522497-134522519 GTGTGTGATGGTGCCCACACAGG - Intergenic
1094051909 12:26229359-26229381 GTGGGTGTGGGTGTACATACTGG - Intronic
1099453341 12:82835000-82835022 GGGCATGGTGGTGCACACTCAGG - Intronic
1106585768 13:31055076-31055098 GTGCGTGTTTGTGCACACAGGGG - Intergenic
1106656870 13:31755954-31755976 GGGTGTGCTGGTGCACACTTCGG - Intronic
1107559907 13:41549646-41549668 GGGGGCGTCGGTGCACAGAGCGG + Intergenic
1110948666 13:81456961-81456983 GGTAGTGTTGGTGAACTCACTGG + Intergenic
1112632833 13:101180770-101180792 GGCAGTGTTGGTACCCACACAGG - Intronic
1114351102 14:21852266-21852288 GAGGGCGATGCTGCACACACTGG + Intergenic
1118329322 14:64803500-64803522 GTGGGTGTTAGTGCACATTCTGG - Intronic
1119320522 14:73727410-73727432 AGGGGTGTGGGTGGCCACACTGG - Intronic
1121343075 14:93116281-93116303 GGGGGGGTGGGTGAACACCCAGG + Intronic
1121511113 14:94514282-94514304 GGGGGTGGGTGTGGACACACTGG - Intronic
1122830003 14:104391233-104391255 GGGAGGCCTGGTGCACACACTGG + Intergenic
1126122778 15:45268342-45268364 GGGGGAATTGGTGGACATACAGG + Exonic
1127982974 15:64047510-64047532 GGGTGTGTGTGTGCTCACACTGG - Intronic
1130650520 15:85759821-85759843 AGGGGTGTTGGTGCCCTGACAGG - Exonic
1131622107 15:94079273-94079295 GGGGGTATTGATAAACACACTGG + Intergenic
1132559000 16:584914-584936 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559020 16:584966-584988 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559040 16:585018-585040 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559060 16:585070-585092 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559080 16:585122-585144 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559100 16:585174-585196 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559120 16:585226-585248 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559140 16:585278-585300 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132559160 16:585330-585352 GGGGGTGTTGGTGGACCCGGTGG - Intergenic
1132575098 16:660517-660539 GGCTGTGTTGGGGCACACCCAGG - Intronic
1132641177 16:979333-979355 GGACGTGTTGGTGCACTCCCGGG - Intronic
1133270716 16:4609721-4609743 GGGGGTGTTGGAGTCCACAGGGG + Exonic
1133927738 16:10206716-10206738 TGGGGTGTGGGTGTACCCACTGG - Intergenic
1135654508 16:24235962-24235984 GAGAGTGTTGGCGCCCACACTGG + Intergenic
1135837206 16:25837257-25837279 GTGGGTGTGGGTTCACACCCAGG - Intronic
1137385995 16:48043024-48043046 GGGGGTGGTGGTGCAAACACAGG + Intergenic
1137569718 16:49557517-49557539 GGGGGTGGTGGTGGGGACACGGG + Intronic
1138346576 16:56324033-56324055 GGGGGTGTTGCTGCCAGCACAGG + Intronic
1141201713 16:81903383-81903405 GGGGATGTTGGTGCCCCCATGGG + Intronic
1141546974 16:84776714-84776736 AGGGGTGTGTGTGCTCACACTGG - Intronic
1142035959 16:87862223-87862245 GGGGGTGGTGCTGGACACCCAGG + Intronic
1142219677 16:88847884-88847906 GTGGGTGTTGGTTCATGCACAGG - Intronic
1142337908 16:89502190-89502212 GGGTGTCTTGGTGCCCACTCTGG - Intronic
1144291842 17:13834144-13834166 GGTGTTTTTGGTTCACACACTGG - Intergenic
1144843588 17:18203951-18203973 GGGGCTTTTGGGGCACACAGGGG + Intronic
1146451223 17:32975539-32975561 GGGGGTCTTGGTCCTCACATTGG + Intronic
1147202397 17:38811699-38811721 GGGGGTGTTAGTGCACGGCCAGG - Intronic
1148130012 17:45256909-45256931 AGGGGTGGTGGGGCACACCCAGG - Intronic
1148466444 17:47867908-47867930 GGGGTGGTTGGGGGACACACAGG - Intergenic
1148500881 17:48090044-48090066 AGGGGTGGTGGTGCACGCCCTGG - Intronic
1148794438 17:50190309-50190331 GGGGGTCTTGGTACTCACAGGGG + Exonic
1151584699 17:75002037-75002059 GGGCGGGGTGGTGGACACACAGG - Intronic
1158075744 18:53526691-53526713 GGGGCTGTTGGCACAGACACAGG - Exonic
1160390072 18:78523409-78523431 GTGGGTGTGGCTGCAGACACGGG + Intergenic
1161368441 19:3894806-3894828 GGGTGTGGTGGTGCACACCTAGG + Intronic
1161568795 19:5018620-5018642 GAGGTCGTTGGTGCACTCACAGG + Intronic
1162667099 19:12223037-12223059 GGGTGTGTGTGTGTACACACAGG + Intergenic
1162991468 19:14305388-14305410 GGGTGTGGTGGTGCACCTACAGG - Intergenic
1166083373 19:40458831-40458853 GGGTGTGGTGGTGCACACTGTGG - Intronic
1166319230 19:42006172-42006194 GGAGGTGGAGGTGCACTCACCGG - Intronic
1166345998 19:42166201-42166223 GGGTATGTGTGTGCACACACTGG + Intronic
1166786071 19:45368012-45368034 GGGGGTGGTGGTGTACACGTCGG - Intronic
1168384765 19:55953942-55953964 AGGCGTGGTGGTGCACACGCCGG - Intronic
1168492562 19:56822892-56822914 AGGGGTGTTTGTGCACATGCAGG - Intronic
1168644178 19:58049467-58049489 GGGGGTGCTGGTGCACATTCAGG + Intronic
924990054 2:306536-306558 CGGGGTGTTAATACACACACAGG + Intergenic
924990061 2:306571-306593 CGGGGTGTTAATACACACACAGG + Intergenic
924990068 2:306606-306628 CGGGGTGTTAATACACACACAGG + Intergenic
924990087 2:306707-306729 CGGGGTGTTAATACACACACAGG + Intergenic
924990094 2:306742-306764 CGGGGTGTTAATACACACACAGG + Intergenic
924990101 2:306777-306799 CGGGGTGTTAATACACACACAGG + Intergenic
924990148 2:307022-307044 CGGGGTGTTAATACACACACAGG + Intergenic
924990179 2:307198-307220 CGGGGTGTTAATACACACACAGG + Intergenic
924990186 2:307233-307255 CGGGGTGTTAATACACACACAGG + Intergenic
924990193 2:307268-307290 CGGGGTGTTAATACACACACAGG + Intergenic
924990200 2:307303-307325 CGGGGTGTTAATACACACACAGG + Intergenic
924990212 2:307373-307395 CGGGGTGTTAATACACACACAGG + Intergenic
924990219 2:307408-307430 CGGGGTGTTAATACACACACAGG + Intergenic
924990235 2:307513-307535 CGGGGTGTTAATACACACACAGG + Intergenic
924990242 2:307548-307570 CGGGGTGTTAATACACACACAGG + Intergenic
924990249 2:307583-307605 CGGGGTGTTAATACACACACAGG + Intergenic
924990256 2:307618-307640 CGGGGTGTTAATACACACACAGG + Intergenic
924990263 2:307653-307675 CGGGGTGTTAATACACACACAGG + Intergenic
924990270 2:307688-307710 CGGGGTGTTAATACACACACAGG + Intergenic
924990277 2:307723-307745 CGGGGTGTTAATACACACACAGG + Intergenic
924990294 2:307828-307850 CGGGGTGTTAATACACACACAGG + Intergenic
924990301 2:307863-307885 CGGGGTGTTAATACACACACAGG + Intergenic
924990308 2:307898-307920 CGGGGTGTTAATACACACACAGG + Intergenic
924990315 2:307933-307955 CGGGGTGTTAATACACACACAGG + Intergenic
924990327 2:308003-308025 CGGGGTGTTAATACACACACAGG + Intergenic
924990346 2:308109-308131 CGGGGTGTTAATACACACACAGG + Intergenic
924990363 2:308215-308237 CGGGGTGTTAATACACACACAGG + Intergenic
924990387 2:308356-308378 CGGGGTGTTAATACACACACAGG + Intergenic
924990399 2:308426-308448 CGGGGTGTTAATACACACACAGG + Intergenic
924990406 2:308461-308483 CGGGGTGTTAATACACACACAGG + Intergenic
924990413 2:308496-308518 CGGGGTGTTAATACACACACAGG + Intergenic
924990420 2:308531-308553 CGGGGTGTTAATACACACACAGG + Intergenic
924990439 2:308637-308659 CGGGGTGTTAATACACACACAGG + Intergenic
924990480 2:308882-308904 CGGGGTGTTAATACACACACAGG + Intergenic
926315624 2:11707629-11707651 CTGGGTGGTGGTGCACGCACGGG + Intronic
926924491 2:17973422-17973444 GGTAGTGTTGGTGCACAAAAGGG + Intronic
927252120 2:21005726-21005748 GGGGTTTTTGGTGTACACAAAGG + Exonic
932397152 2:71456047-71456069 GGGGGAGCTGCTCCACACACAGG - Intronic
935272470 2:101446809-101446831 GGGGGTGGGGGGGCACACAATGG + Intronic
935502579 2:103859080-103859102 GTGTGTGTTTGTGCACGCACAGG - Intergenic
942324168 2:174761453-174761475 GGGTGTGGTGGTGCGCACCCAGG - Intronic
942719916 2:178939764-178939786 GGGGGTGTTGGGGGACAAATGGG + Intronic
947408172 2:229803252-229803274 GGGTGTGGTGGTGCACACCTGGG - Intronic
947444911 2:230156306-230156328 GGGGGTGTTGGAGTGAACACTGG - Intergenic
947446580 2:230168558-230168580 GGGGGTTTTGGGGCACATGCAGG - Intronic
947988298 2:234467157-234467179 TGTGGTGTTGGGGCACAAACAGG - Intergenic
948464872 2:238147625-238147647 GGGGGTGGGGGTGGACACTCGGG - Intronic
948818607 2:240526809-240526831 GTGGGTGTTGGTGCTGAGACTGG - Intronic
1168866471 20:1091037-1091059 GGGGGTGGGGGTCCAAACACAGG + Intergenic
1169732529 20:8801899-8801921 GGGGGTGTTGGAGCAGATAAAGG + Intronic
1171010026 20:21504491-21504513 GGAGGTGCTGGTGTACATACAGG + Intergenic
1171275944 20:23856532-23856554 ATGTGTGTTTGTGCACACACGGG - Intergenic
1172386956 20:34540787-34540809 GGGAAGGTTGGTGCACACAGGGG - Exonic
1174176476 20:48648585-48648607 AGGGGTGTTTGTCCACAGACTGG - Intronic
1175715299 20:61251656-61251678 GGGTGTTTTGATGCACACACAGG + Intergenic
1178157232 21:29869030-29869052 GGGGATCTTGCTGCCCACACAGG - Intronic
1179614865 21:42576108-42576130 TGGGGTGGTTGTGCCCACACTGG + Intronic
1180067531 21:45420110-45420132 GGGGGAGCTGCTGCACACTCAGG - Intronic
1181001205 22:19988582-19988604 GGGAGTGCTGCTGCACTCACTGG - Intronic
1181060239 22:20278866-20278888 GGGGGCTTTTGTGCACACATGGG - Intronic
1181549264 22:23627642-23627664 GGGGGTGCACGTGCACACAGGGG + Intronic
1183335016 22:37241473-37241495 GAGGCTGTGGGTGCCCACACAGG + Intronic
1183507921 22:38219800-38219822 GGGAGGGTGGGTGCAGACACAGG - Exonic
1184260750 22:43314464-43314486 GGGGGTGCTGCTGCAGCCACAGG - Intronic
1184508981 22:44921112-44921134 GGGCAGGTTGGTGCACACCCAGG - Intronic
1185345565 22:50309159-50309181 GGGGCTGAGGGTGCACACAGGGG - Exonic
949480042 3:4485025-4485047 GGGTGTGGTGGTGCACACCCAGG - Intergenic
949873333 3:8607725-8607747 GGCAGTGTTTATGCACACACTGG - Intergenic
952898288 3:38093778-38093800 TTGGGTATTGGGGCACACACAGG - Intronic
952978948 3:38719819-38719841 GAGGCTGTTGGTGCCCACTCAGG + Intronic
954068038 3:48122530-48122552 GGGGGTGCTGGTGCACAGATGGG + Intergenic
954401678 3:50322543-50322565 GGGGCTGGTGGTGCAGACGCGGG - Exonic
954948601 3:54448670-54448692 TGGGGTATTGGTGCCCACAGAGG - Intronic
955747397 3:62153881-62153903 GGGGGTGCTGGTGCAGGCAGTGG + Intronic
962829719 3:139129307-139129329 GGAGGTCTTGGTGCACAAAGAGG + Intronic
965010248 3:163078459-163078481 TGGGGTGTTGGGGGACAGACAGG + Intergenic
967917276 3:194588055-194588077 GGGGGCCTTGGGTCACACACAGG - Exonic
968973298 4:3807808-3807830 GGGGGTGTTGATTCAAATACTGG - Intergenic
972672086 4:41222366-41222388 GGAGTTGTTAGTGCAGACACTGG + Intergenic
973981702 4:56313511-56313533 GGCGGTGTTGGGGAATACACAGG + Intronic
976741419 4:88361068-88361090 GGGAATGGTGGTCCACACACGGG - Intergenic
979963399 4:127048615-127048637 GGCGGTGTGAGTGCACACCCAGG + Intergenic
982253873 4:153433786-153433808 AGGGGTGTTGGGGAGCACACTGG - Intergenic
982336147 4:154240671-154240693 GGTGGTGTTGGTGAAAACATTGG - Exonic
983653187 4:170053721-170053743 GGGTGTGGCGGTGCACACACAGG - Intergenic
984316933 4:178140624-178140646 GGGTATGCCGGTGCACACACTGG - Intergenic
985986260 5:3518924-3518946 GGGTGTGGAGGAGCACACACAGG + Intergenic
988365283 5:30290494-30290516 GTGGCTGTGGGTGCAGACACAGG - Intergenic
990757170 5:59086531-59086553 GGGGGTGAAGGTACTCACACAGG - Intronic
991029231 5:62065560-62065582 AAGGGTGTGTGTGCACACACAGG + Intergenic
991484490 5:67120294-67120316 GAGGATGATGGTGCCCACACAGG + Intronic
992134172 5:73726163-73726185 AGGGGTATTTGTGCACACACAGG - Intronic
995115125 5:108470852-108470874 AGAGGTGTTAATGCACACACAGG - Intergenic
995713323 5:115056436-115056458 GGGGGTGTGGTTGGAAACACGGG + Intergenic
999244572 5:150147159-150147181 GGGGGTGCTGGGGCCCCCACAGG - Intronic
1002663146 5:180804305-180804327 GGGGGTGTTGGGGGGCGCACAGG - Intronic
1003173942 6:3741055-3741077 AGGGCAGCTGGTGCACACACAGG - Intronic
1004947354 6:20630291-20630313 GAGGGTGTCAGGGCACACACAGG - Intronic
1010834167 6:80566443-80566465 GGGGGGGTTGGTACACACACAGG - Intergenic
1015502130 6:133945332-133945354 GGGGGTGTTGTTGCAGGAACTGG + Intergenic
1017099723 6:150837241-150837263 GTGTGTGTGTGTGCACACACAGG + Intronic
1017644775 6:156528786-156528808 GTGCGTGTTGGTGTAGACACTGG + Intergenic
1020157835 7:5741290-5741312 GGGGCTGTTGGTTCAGAGACTGG + Exonic
1021194694 7:17662381-17662403 GTGGGTGTGTGTGCACACACAGG - Intergenic
1030573801 7:111261264-111261286 GGAGGTGTTGGTGAATATACGGG - Intronic
1034128825 7:148698286-148698308 GGGGGTGGGGGTGCGCACAAGGG + Intronic
1034545540 7:151786369-151786391 GGGCGTGAGGGTGAACACACAGG + Intronic
1035376586 7:158410813-158410835 AGGGGTGTTGGTGGAGTCACGGG + Intronic
1037470045 8:19199140-19199162 GGAGGTGTTGGTATACACTCAGG - Intergenic
1040572890 8:48625381-48625403 AGGGGAGTTAGTGCACACCCAGG + Intergenic
1042232049 8:66567919-66567941 GGGGGTGGTGGTGTGCACCCCGG + Intronic
1044721971 8:95159793-95159815 GAGGGTGTTGGAGCTCAAACAGG - Intergenic
1047807312 8:128373885-128373907 GGTGGTGCTGGTGCAGTCACTGG + Intergenic
1047871956 8:129093807-129093829 GGGAGTGTGCCTGCACACACAGG - Intergenic
1048047883 8:130790618-130790640 GGTGGTGGTGGGGCACAGACAGG + Intronic
1050795510 9:9535832-9535854 AGGGGTGTGTGTGTACACACAGG + Intronic
1051361060 9:16282093-16282115 GTGGGTGTAGGGGCACACACTGG - Intergenic
1054847958 9:69816867-69816889 GGGGGGATTGGGGGACACACTGG - Intergenic
1054963018 9:70990669-70990691 GTGTGTGTGAGTGCACACACAGG + Intronic
1055266297 9:74498775-74498797 GGAGGTGCTGGTGCACCCTCGGG + Intronic
1059414244 9:114153724-114153746 GGGGGTGTTCCTGCACTCCCTGG + Intergenic
1060527225 9:124327456-124327478 GGGGCTGCTGGGGCACAGACAGG - Intronic
1061593533 9:131614123-131614145 GGGGGTGTTGGTGCACACACTGG - Intronic
1061845378 9:133385255-133385277 GGAGGAGGTGGTGCAGACACCGG - Intronic
1061937075 9:133863816-133863838 GGGGCTGCTGGAGCAGACACCGG + Intronic
1062227881 9:135463930-135463952 GGAGGGGCAGGTGCACACACTGG + Intergenic
1062320113 9:135986603-135986625 TGGGCGGTTGGTGCACACACAGG + Intergenic
1062599568 9:137313764-137313786 GGGGCTGTAGGAGCACACTCTGG + Intronic
1062681604 9:137785000-137785022 GGGGGTGGTCGTCCAGACACAGG + Intronic
1062736198 9:138138676-138138698 AGGTGTGTGTGTGCACACACAGG + Intergenic
1186514291 X:10154760-10154782 GTGGTTTGTGGTGCACACACAGG + Intergenic
1192263662 X:69524236-69524258 GGGTGTGGTGGTGCACACCTTGG - Intronic
1198195659 X:134358572-134358594 CCGGGTGTTGTGGCACACACCGG + Intergenic