ID: 1061593538

View in Genome Browser
Species Human (GRCh38)
Location 9:131614136-131614158
Sequence CAACACCCCCCCCCAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061593529_1061593538 20 Left 1061593529 9:131614093-131614115 CCATGTGGACCGTGCAAAGGGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data
1061593533_1061593538 -10 Left 1061593533 9:131614123-131614145 CCAGTGTGTGCACCAACACCCCC 0: 1
1: 0
2: 2
3: 12
4: 234
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data
1061593532_1061593538 11 Left 1061593532 9:131614102-131614124 CCGTGCAAAGGGAGGGTCAGACC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061593538 Original CRISPR CAACACCCCCCCCCAAGGAG GGG Intronic
No off target data available for this crispr