ID: 1061594291

View in Genome Browser
Species Human (GRCh38)
Location 9:131618982-131619004
Sequence AGGCACACGCTTCCAAGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061594284_1061594291 22 Left 1061594284 9:131618937-131618959 CCGCAGAAGGGCAGGGGCCGCGA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG No data
1061594283_1061594291 23 Left 1061594283 9:131618936-131618958 CCCGCAGAAGGGCAGGGGCCGCG 0: 1
1: 0
2: 1
3: 29
4: 232
Right 1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG No data
1061594287_1061594291 5 Left 1061594287 9:131618954-131618976 CCGCGACGGGCAGCAGAACACAT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061594291 Original CRISPR AGGCACACGCTTCCAAGGAA CGG Intronic
No off target data available for this crispr