ID: 1061594794

View in Genome Browser
Species Human (GRCh38)
Location 9:131621810-131621832
Sequence TGGGGGGTAGGGCGGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 849}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061594786_1061594794 -8 Left 1061594786 9:131621795-131621817 CCAGCTGCCGCTGCTTGGGGGGT 0: 1
1: 0
2: 0
3: 19
4: 302
Right 1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG 0: 1
1: 0
2: 7
3: 76
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061594794 Original CRISPR TGGGGGGTAGGGCGGGCGGC GGG Exonic
900106643 1:984243-984265 TGGGGGGCAAGTCGGGGGGCGGG + Intergenic
900141601 1:1141302-1141324 TGGGGGTGAGGGCGGGGGGATGG - Intergenic
900154566 1:1198794-1198816 TGGGGGGTGGGCCTGGGGGCGGG - Intergenic
900172055 1:1273974-1273996 TGGGGGATGGGGCGGGGGGCGGG + Intergenic
900174128 1:1284322-1284344 GGGGGGGTGGGGCTGGCGGGGGG + Intronic
900186620 1:1336037-1336059 TGGGGGCCAGGACGGGAGGCAGG - Exonic
900435523 1:2628979-2629001 TGGGCGGAGGGGCGGGCGACGGG + Intronic
900733418 1:4278626-4278648 TGGGGGTTAGGGGGAGGGGCTGG + Intergenic
900804249 1:4756968-4756990 TGGGGGAAAGGGCTGGGGGCAGG - Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900971150 1:5993021-5993043 TGAAGGGTCGGGCGGGCGGGAGG - Intronic
901332887 1:8424113-8424135 TGGGGCGGAGGGCGTGCGGCCGG - Intronic
901660085 1:10793895-10793917 GGGGGAGTGGCGCGGGCGGCCGG + Intronic
901836294 1:11926111-11926133 TGGGGGGTCCGGCGCGCGGCGGG - Exonic
901843063 1:11965704-11965726 TGGGGTGAAGGGAGGGTGGCAGG - Intronic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
902551269 1:17220981-17221003 TGAGGGGTAGGGTGGGGGCCCGG + Intronic
903181765 1:21608459-21608481 TGGGGAGTGGGGAGGGCGGAGGG + Intronic
903211040 1:21818867-21818889 GGAGGGGTGGGGCGGGGGGCGGG - Intronic
903263436 1:22143157-22143179 CGGGCGGGCGGGCGGGCGGCCGG + Intronic
903408282 1:23117507-23117529 TGGGGGGGGGGGCGGGGGGGGGG + Intronic
903483178 1:23669482-23669504 AGGGAGGGAGGGCGGGCGGGTGG + Intergenic
903739371 1:25549738-25549760 TGGCGAGTAGGGCGGGTGGCGGG + Intronic
904032890 1:27544152-27544174 TGTGGGATAGGGCGGGAGGCAGG + Intronic
904622145 1:31782097-31782119 TGGGGGGCAGGGCAGGAGGGAGG - Intergenic
904748983 1:32729098-32729120 TGGGGGGTGGGGTGGGGTGCAGG + Intergenic
904870546 1:33615103-33615125 CAGGGGGCAGGGTGGGCGGCAGG + Intronic
905250664 1:36646315-36646337 TGGGGTGGTGGGCAGGCGGCTGG - Intergenic
905647234 1:39633152-39633174 CGGGGCGGAGGGCGGGCGGCCGG - Intronic
905865887 1:41376439-41376461 TGGGGAGCAGGGTGGGGGGCTGG + Intronic
905874613 1:41423968-41423990 TGGGGTGTGGGGCTGGCAGCTGG - Intergenic
905896002 1:41546125-41546147 TGGGGTGGAGGGTGGGCAGCAGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906614686 1:47226034-47226056 GTGGGGCTAGGGCGGGAGGCCGG + Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
907526740 1:55058172-55058194 TGGGGGGCAGGGCGGCCACCAGG - Exonic
907556956 1:55352451-55352473 TGGGGGGTAGTGCTGGGGGTTGG + Intergenic
907663468 1:56414541-56414563 TGGGGGGCAGGGTGGGGGGCTGG - Intergenic
907920025 1:58903707-58903729 TGGGCGGGAAGCCGGGCGGCGGG - Intergenic
907964956 1:59319872-59319894 TGGGGGGAAGGGCTGGAGGGTGG + Intronic
908229241 1:62087378-62087400 TGGGGGGCGGGGCGGGCCGTAGG + Intronic
908401957 1:63779810-63779832 TGGGGGGTGTGGCTGGGGGCAGG - Intronic
908457819 1:64321274-64321296 TGGGGGGTGGGGGGGGGGGGTGG + Intergenic
908495432 1:64689666-64689688 TGGAGGGTAGGGCAGGTGGGAGG - Intronic
910678909 1:89843229-89843251 TGGGGGGTAGGGGTGGGGGTTGG + Intronic
910815040 1:91283136-91283158 CAGGAGGTAGGGAGGGCGGCAGG - Intronic
911413442 1:97540331-97540353 TGGGGGGTGGGGGTGGCGGCGGG + Intronic
912392972 1:109317575-109317597 GGGGTGGTTGGGCGGGAGGCAGG + Intronic
912436807 1:109667989-109668011 TCGGGGGCAGGGCGGGCCGTGGG + Intronic
912471768 1:109911370-109911392 TGGCGGGTAGGGAGAGAGGCAGG - Intronic
912625856 1:111204223-111204245 CCGGGGCTAGGGCTGGCGGCTGG - Intronic
913275798 1:117136707-117136729 TGGGGGGTGGGGTGGGGGGTAGG + Intergenic
913718490 1:121565173-121565195 TGGGGGGTTGGGCAGGGGGCAGG - Intergenic
915301550 1:154954362-154954384 TGGGGGGTAGGCCCGGCTGTGGG + Intronic
915530135 1:156498598-156498620 TGGGGGGAAGGGGGGGAGGGGGG - Intronic
915557158 1:156667240-156667262 TGGGGGGTAGGGTGGGCACCAGG + Intergenic
915564564 1:156706401-156706423 TAGGGGGAAGGGAGGGAGGCGGG + Intergenic
916144550 1:161727160-161727182 AGGGGCGTAGGGCGGTGGGCGGG - Intronic
916331178 1:163619013-163619035 TGGGGGGAAGGGTGGGAGGGGGG - Intergenic
916590724 1:166187552-166187574 TGGGGGGAAGGGTGGGAGGGGGG + Intergenic
917312220 1:173690052-173690074 GGGGGGGGGGGGCGGGGGGCAGG - Intergenic
917433979 1:175000247-175000269 ACGGCGGTAGGGCGGGAGGCTGG - Intronic
917435469 1:175016948-175016970 TAGGGGGTATGGCGGGCAGGGGG - Intronic
917897939 1:179510892-179510914 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
918080913 1:181207089-181207111 AGGGAGGGAGGGCGGGCGGGTGG - Intergenic
918904809 1:190478206-190478228 TGGGGGGTGGGGGGTGCGGGCGG + Intergenic
919422688 1:197390180-197390202 TGGGGGGGAGGGGGTGGGGCGGG + Intronic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919705162 1:200669440-200669462 TGGGCGGGACGGCGGACGGCTGG + Intronic
919723646 1:200866989-200867011 TGGGGTGGGGGGCGGGGGGCGGG - Intergenic
919770990 1:201158432-201158454 TGGGGGGTGGGGGCGGGGGCAGG + Intronic
920111875 1:203592597-203592619 TGGGGGATGGGGTGGGGGGCAGG + Intergenic
920144004 1:203842231-203842253 TGGGAGGCAAGGCAGGCGGCTGG + Intronic
920307219 1:205026715-205026737 TGGGGGCTGGGGCTGGGGGCTGG - Intergenic
920358474 1:205394214-205394236 TGGGGGGTAGAGCGACTGGCGGG + Intronic
921642960 1:217578078-217578100 ATGGGGGTGGGGCGGGGGGCGGG + Intronic
921845041 1:219869430-219869452 TGGGGTGTGGGGAGGGGGGCGGG + Intronic
922173696 1:223178447-223178469 TGGGGAGGAGGGAGAGCGGCTGG + Intergenic
922695306 1:227728417-227728439 GGGCAGGCAGGGCGGGCGGCGGG - Intergenic
922764165 1:228149015-228149037 TGGTGGTTAGGGTGGGCTGCCGG - Intergenic
922764390 1:228149796-228149818 TGGGGGGCAGGGCAGCGGGCAGG - Intergenic
922783758 1:228273004-228273026 TGGTGGGGAGGGCTGGCGACAGG + Intronic
923380796 1:233415909-233415931 TGGGCGGGAGGGCGGGTGGAGGG + Intergenic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
924261208 1:242233553-242233575 TTGGAGGTAGTGAGGGCGGCAGG + Intronic
924261218 1:242233577-242233599 AGGGAGGGAGGGCTGGCGGCAGG + Intronic
924436661 1:244048847-244048869 TGGGGGGTGGGGGGGCCGGGAGG + Intergenic
924436803 1:244049231-244049253 TGCGGGGTCGGGCGGGGTGCGGG + Intronic
924450539 1:244175044-244175066 GGGGGGGTGGGGCGGGGGGGAGG - Intergenic
924818393 1:247463260-247463282 TGGGGGGCAGGGCGAGCCACGGG + Intergenic
1062833160 10:619531-619553 TGGGTGGGAGGGCGGGCGGGCGG - Intronic
1063369479 10:5511926-5511948 TGGGGGGTGGGGTGGGGGGCAGG - Intergenic
1063446550 10:6121508-6121530 GGGGGGGGGGGGGGGGCGGCGGG + Intergenic
1063476095 10:6330345-6330367 TGGAGGGCAGCGTGGGCGGCGGG + Intergenic
1063661598 10:8037861-8037883 TGGGGGGGGGGGCGGGTGGGCGG + Intergenic
1063944636 10:11165033-11165055 AGGGCGGTGGGGCGGGGGGCGGG + Intronic
1064103822 10:12484825-12484847 TGGGGGGGAGGGGGTGGGGCTGG + Intronic
1064167848 10:13001771-13001793 CAGGGGGCAGGGCGGGAGGCGGG - Intronic
1064643314 10:17435704-17435726 TGGGGGGTTGGGGGGGTGGGGGG + Intronic
1065727360 10:28678274-28678296 TGGGGGCTCGGGCGGCCGGGAGG + Intronic
1066035282 10:31475059-31475081 TGTGGGGTGGGGCGGGGGGGAGG + Intronic
1066372511 10:34829390-34829412 TGGGTGGTGGGGCGGGAAGCTGG + Intergenic
1067102419 10:43342881-43342903 TGGGGTGGAGGGTGGGGGGCCGG - Intergenic
1067175627 10:43943577-43943599 TGGGGGGTGGGGAAGGTGGCAGG + Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1069755410 10:70771787-70771809 TGGGGGGCAGGGGTGGCAGCAGG - Intronic
1069994134 10:72332330-72332352 TGGAGAGGAGGGCGGGCTGCGGG + Intergenic
1070768767 10:79070492-79070514 CGGGCGGGAGGGCGGGCGGACGG + Intronic
1070806693 10:79274956-79274978 CGAGGGGTGGGGCGGGCAGCAGG + Intronic
1071044925 10:81361933-81361955 TAGGGGGTAGGGCGGGGGTGAGG - Intergenic
1071492373 10:86144530-86144552 AGGGGGAGAGGGCGAGCGGCCGG - Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1072190107 10:93071683-93071705 AGGGGGGCAGGGCGGGGGGTGGG - Intergenic
1073051161 10:100668229-100668251 TGGGGGGAGGGGCGGGAGGAGGG - Intergenic
1073305746 10:102502293-102502315 TGGGGGAGAGGGCGGGCGACGGG + Intronic
1073701439 10:105931506-105931528 TGGGGGAAAGGGTGGGAGGCAGG + Intergenic
1073874198 10:107902357-107902379 TGGGGGGGGGGGGGGGCGGGTGG + Intergenic
1074086127 10:110210028-110210050 TGGGGGGTGGGGGGTGGGGCAGG - Intronic
1075231579 10:120684542-120684564 TGGGGCGGGGGGCGGGGGGCAGG - Intergenic
1075438398 10:122461435-122461457 CGGGAGGGAGGGCGGGCGGCTGG - Intergenic
1075678077 10:124310430-124310452 TGGGGGGTAGGGGCAGCGGTGGG + Intergenic
1075710937 10:124530210-124530232 GGAGGGGTGGGGCGGGAGGCAGG - Intronic
1075885718 10:125897115-125897137 AGGGGTGTGGGGCGGGGGGCGGG - Intronic
1076421592 10:130335863-130335885 TGGTGGGTAGGGAGGGAGACAGG + Intergenic
1076870040 10:133188676-133188698 TGGGGGGTGGGGACGGCGGGGGG - Intronic
1076883815 10:133252318-133252340 TGTGGGGCAGGACGGGCTGCTGG - Intergenic
1076921014 10:133454661-133454683 TGTGGGGCTGGGCGGGAGGCAGG + Intergenic
1077037786 11:503616-503638 TGGGCGGGAGGGCGGGTGGAAGG + Intronic
1077231717 11:1460774-1460796 CTCGGGGCAGGGCGGGCGGCGGG - Exonic
1077331627 11:1986572-1986594 TGGGGGGCATGGCGGGGGGCGGG - Intergenic
1077453025 11:2662375-2662397 TGGGGGGCAGGGGAGGGGGCTGG - Intronic
1077859274 11:6160510-6160532 TGGGGGGTAGGGGGGCAGGGGGG + Intergenic
1078537290 11:12185194-12185216 TGGGGGGATGGGTGGGTGGCAGG + Intronic
1078599763 11:12719573-12719595 TTGGGGGGAGGGGGGGCGGGGGG + Intronic
1078845381 11:15114867-15114889 CGGGGGGTGGGGCGGGGGCCAGG + Intronic
1079163215 11:18013103-18013125 TGATGGGTAGGGCGCGGGGCGGG + Exonic
1079361932 11:19777083-19777105 TGGGGGGGGGGGTCGGCGGCTGG - Intronic
1079508292 11:21180064-21180086 TTGGGGGCAGGGTGGGCGGGGGG + Intronic
1079719363 11:23790846-23790868 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080815090 11:35747871-35747893 TGGGGGGTACGGTGCGGGGCAGG + Intronic
1081601750 11:44500267-44500289 TGGGAAGTAGGCGGGGCGGCGGG + Intergenic
1081704964 11:45177349-45177371 TTGGGGGAAGGGGGGTCGGCAGG - Intronic
1081737026 11:45411368-45411390 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081737031 11:45411380-45411402 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081868665 11:46373121-46373143 TGGGGGGCAGGGCAGGTGACTGG + Intronic
1081933736 11:46890216-46890238 TGGGGGGCAGGGACGGGGGCAGG + Intronic
1082957065 11:58881728-58881750 TGGGGTGGAGGGAGGGCGGAGGG - Intronic
1083281527 11:61629768-61629790 TGGGGGGTGGGGCAGGGGGTGGG + Intergenic
1083474782 11:62908845-62908867 TGTGGGGCAGGGCCGGAGGCAGG + Exonic
1083593845 11:63909828-63909850 TGGGCGGTGGGGCAGGGGGCGGG + Exonic
1083609859 11:63999606-63999628 CGCGGGGGAGGGCGGGAGGCGGG - Intronic
1083727837 11:64637570-64637592 TGGGGGGTGGGGCGGGCCAGGGG + Intronic
1083734441 11:64671483-64671505 TGGGGGGGAGGTTGGGGGGCAGG - Intronic
1083756055 11:64792225-64792247 TGGTGGGCAGGGCGGCCAGCAGG + Exonic
1083933459 11:65858223-65858245 TGAGGGGTGGGGCGGGCTTCCGG + Exonic
1084010878 11:66347704-66347726 TGGGGGCGGTGGCGGGCGGCGGG - Intergenic
1084030490 11:66477934-66477956 TGGGGGGTAGGGAAGGTTGCTGG + Intergenic
1084153423 11:67301765-67301787 TGGGGAGGAGGGCGGGCACCGGG - Exonic
1084196323 11:67525098-67525120 TGGGGAGGAGGGAGGGAGGCAGG - Intergenic
1084212435 11:67630264-67630286 TGGGAGGGACGGAGGGCGGCGGG + Intergenic
1084362495 11:68677856-68677878 TGGGGGGCGGGGCTGGGGGCTGG + Intergenic
1084403058 11:68956092-68956114 GGTGGGGTAGGGTGGGGGGCTGG + Intergenic
1084430148 11:69106512-69106534 TGGGGGCAGGGCCGGGCGGCCGG - Intergenic
1085472710 11:76768466-76768488 AGGGGGGTTGGGTGGGGGGCTGG - Intergenic
1085533452 11:77204756-77204778 TGGGGAGGAAGGCGGGGGGCTGG - Intronic
1085666143 11:78417444-78417466 CGAGGGGCGGGGCGGGCGGCAGG - Intronic
1086836120 11:91625191-91625213 TGGGGGGAAGAGTGGGCGGGGGG + Intergenic
1088972497 11:114786358-114786380 TGTGGGGTGGGGCGGGGGGCGGG - Intergenic
1089478900 11:118790240-118790262 TGGGGCGTGGGGCGGGGTGCGGG - Intronic
1089537411 11:119169099-119169121 CGGGGGGCAGGGCGGGCCGGGGG + Exonic
1089560186 11:119339850-119339872 TGCGGGGTAAGCGGGGCGGCAGG + Intronic
1089747208 11:120625741-120625763 TTGGGGGGAGGGTGGGCAGCTGG + Intronic
1089860561 11:121586693-121586715 TGGGGGGGGGGGCGGGGGGGGGG + Intronic
1090423964 11:126594252-126594274 TGAAGGGTAGGGCTGGGGGCTGG + Intronic
1090606823 11:128430528-128430550 TGGGGTGTGGGGCGGGGGGAGGG - Intergenic
1202814608 11_KI270721v1_random:41748-41770 TGGGGGGCATGGCGGGGGGCGGG - Intergenic
1091755087 12:3046175-3046197 GGGGGGGTTGGGTGGGAGGCTGG - Intergenic
1092170602 12:6371562-6371584 GTGGGGGTGGGGCGGGGGGCGGG + Intronic
1092282600 12:7109013-7109035 GGGGGGGTAGGGTGGGGGGAGGG + Intronic
1092607330 12:10134814-10134836 TGGAGGGAAGGGCGGGAGGTGGG + Intergenic
1093109550 12:15132973-15132995 TGGGGGGCAGGGCGGGGGCAGGG - Intronic
1093498452 12:19783534-19783556 CGGGGGATCGGGCGGGGGGCGGG - Intergenic
1095066089 12:37777382-37777404 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1095983307 12:47984649-47984671 TTGGGGGCAGAGCGGGCTGCAGG + Intronic
1096073862 12:48789809-48789831 CGGGGGGTTGTGGGGGCGGCAGG - Intergenic
1096197566 12:49658395-49658417 TGAAGGGTAGGGTGGGAGGCAGG + Intronic
1096533878 12:52258561-52258583 TGGCGGCAGGGGCGGGCGGCTGG + Intronic
1096773593 12:53951140-53951162 TGCAGGGTTGGGCGGGGGGCAGG + Intergenic
1096788109 12:54029401-54029423 TGGGGGGGGGGGCGGGGGGGCGG - Intronic
1096854867 12:54473625-54473647 TGGGAGGTGGGGCGAGGGGCCGG + Intergenic
1096983618 12:55743133-55743155 GGGCGGGGCGGGCGGGCGGCCGG - Intergenic
1097164611 12:57076948-57076970 TGCGGGGCGGGGCGGGCGGGGGG + Intronic
1097232978 12:57523204-57523226 TTGGGGAGAGGGCGGGCGGAGGG - Intronic
1097251309 12:57633527-57633549 TGGGGGGCAGGGCGGGGAGGAGG - Intergenic
1097746634 12:63310649-63310671 TGGGGGGCAGGGCAGGCCGTAGG + Intergenic
1097929425 12:65168210-65168232 TGGGAGGCGGGGCGGGGGGCGGG - Intergenic
1098465712 12:70783864-70783886 GGGGGGGGGGGGCGGGGGGCGGG + Intronic
1098710766 12:73757589-73757611 TGGGGGGGAGGGAGGGAGGGAGG + Intergenic
1099109999 12:78546850-78546872 TGGGGGTTAGGGTGGGGGGAGGG + Intergenic
1099576965 12:84393940-84393962 CGGGGGGGGGGGGGGGCGGCGGG - Intergenic
1101124359 12:101615659-101615681 TGGGGGGGCGGGGGGGGGGCGGG - Intronic
1102157458 12:110742636-110742658 TGGAAGGTAAGGGGGGCGGCGGG - Exonic
1102253820 12:111405223-111405245 TGGGGGACAGGACGGGCGGCCGG + Intergenic
1102474499 12:113179911-113179933 TGAGGGGTGGGGCGGTCGACGGG - Intronic
1102646323 12:114406210-114406232 TGGGGGGAAGGGAGGACGGGAGG - Intronic
1102756128 12:115342479-115342501 TGGGGGGCGGGGTGGGGGGCAGG - Intergenic
1103309455 12:119992951-119992973 TGGGGGGCAGGGTGGGGGGGTGG - Intronic
1104050001 12:125188547-125188569 TGGGGGAGAGGGCGGGGGACGGG - Intronic
1104281391 12:127381210-127381232 GGGAGGGGAGGGCGCGCGGCCGG + Intergenic
1104647722 12:130509044-130509066 TGGTGGGGAGGGCCGGGGGCCGG - Intronic
1104900568 12:132187747-132187769 TGGGGCAGAGGGCGGGCTGCCGG + Intergenic
1104964560 12:132503103-132503125 TGGGGGGTGGGGTGGGAGGCGGG - Intronic
1104971008 12:132530713-132530735 TGGGGGGTGGGGCTGGGGGGTGG + Intronic
1105312985 13:19229818-19229840 TGGGGGGCGGGGTGGGGGGCAGG + Intergenic
1105473808 13:20714409-20714431 TGGGGGGCAGTGCGGGCGGCTGG + Intronic
1105657451 13:22456503-22456525 TGGGGAGAAGGGTGGGCAGCAGG - Intergenic
1107733051 13:43367739-43367761 TGGGGGGTGGGGTGGGTGCCAGG + Intronic
1108247539 13:48532907-48532929 TGGCGGGGAGGTCGGGCCGCAGG + Intronic
1108849500 13:54710285-54710307 TGGGGGGTTGGGGGGGTGGCAGG + Intergenic
1110436187 13:75481061-75481083 TCGGGGGCTGGGCGAGCGGCGGG - Intronic
1110856108 13:80298607-80298629 TGGGGGGTGGAGGGGGGGGCGGG + Intergenic
1110983900 13:81939194-81939216 TGGGGGGTAGGGTGAGGGGAGGG + Intergenic
1111869468 13:93812142-93812164 TGGGGGGGGGGGCGGGGGGTGGG + Intronic
1111891838 13:94092119-94092141 TGCGGGGTGGGGCGGGGGGCGGG + Intronic
1112430620 13:99347313-99347335 TGGGGGGGGGGGGGGGCGCCCGG - Intronic
1112580777 13:100674840-100674862 GGGGGGGTCGGGTGCGCGGCGGG - Intronic
1113039191 13:106085708-106085730 TGGGGGGTGGGGAGGGGGGGCGG + Intergenic
1113552311 13:111202207-111202229 TGTGGGGTAGTGCAGGTGGCAGG + Intronic
1113598632 13:111552646-111552668 AGGGAGGTAGGGCAGGAGGCTGG - Intergenic
1113643622 13:111976346-111976368 TGGGTGGGTGGGCGGGCGGGGGG + Intergenic
1113663060 13:112120173-112120195 TGGGAGGCAGGGTGGGAGGCAGG + Intergenic
1113769398 13:112898700-112898722 TGGGGGGCAGGGAGGCCGTCTGG - Intronic
1113841575 13:113364198-113364220 GGGGGGGCAGGGCGGGGGGAGGG + Intergenic
1113942405 13:114025111-114025133 GGGGGGGCAGGGAGGGAGGCCGG - Intronic
1113960665 13:114124046-114124068 TGGGGGCTGGGCCGGGGGGCTGG - Intronic
1114259204 14:21025235-21025257 GGGGGCGAGGGGCGGGCGGCTGG + Intronic
1115062333 14:29208432-29208454 TGGGGGGTAGGGGGGGCTAGGGG - Intergenic
1116223835 14:42122035-42122057 TGGGGGGAAGGGTGGGAGGAAGG + Intergenic
1117204963 14:53432520-53432542 TGGGGGGTGGTGCGTGAGGCAGG + Intergenic
1118059596 14:62120832-62120854 TGGGGGGAAGGGGTGGCGGAAGG + Intergenic
1118265794 14:64294168-64294190 TGCGGGGCAGGGCTGGCGCCCGG - Exonic
1118313388 14:64708807-64708829 TGGGGGGTGGGGCGGGGGGGTGG - Intronic
1118568788 14:67172247-67172269 AGGGGGATGCGGCGGGCGGCGGG - Intronic
1118576003 14:67241598-67241620 GCGGGGGAGGGGCGGGCGGCCGG + Intronic
1118610035 14:67532993-67533015 GGGGCGGCAGGGAGGGCGGCGGG - Intronic
1118719813 14:68586055-68586077 TGGGGGTAAGGGAGGGCTGCAGG - Intronic
1119140862 14:72265938-72265960 TGGGGGGGGGGGCGGGAGGCAGG + Intronic
1119406880 14:74404599-74404621 TGGGGAGTAGGGAAGGAGGCAGG + Intergenic
1120010999 14:79414106-79414128 TGCGGGGGAGTGGGGGCGGCAGG + Intronic
1120526712 14:85584925-85584947 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1120787978 14:88554608-88554630 CGGCGGGAGGGGCGGGCGGCTGG - Intronic
1120993346 14:90397521-90397543 TGCGGGGCTGGGCGGGGGGCAGG - Intronic
1121009368 14:90510924-90510946 TGTGTGGGAGGGCAGGCGGCAGG - Intergenic
1121011231 14:90521377-90521399 TGGGAGGTAGGGTGGGGGCCAGG + Intergenic
1121050535 14:90816562-90816584 CGGGGGCTAGGGCGGGAGACAGG + Intergenic
1121120423 14:91372526-91372548 TGCGGGGGGGGGCGGGCGGGGGG + Intronic
1121366809 14:93320260-93320282 TGGGGGTTAGGGAGGGTGGAAGG - Intronic
1121468274 14:94129677-94129699 AGCGGGGTGGGGCGGGGGGCGGG - Intronic
1121528463 14:94636238-94636260 TGGGGGAAAGGGCGGGAGGTGGG + Intergenic
1121689405 14:95865427-95865449 TGGGGGGGGGGGTGGGGGGCGGG - Intergenic
1122128955 14:99594019-99594041 TGGGGGTGGGGGCGGGGGGCGGG + Intronic
1122263920 14:100538057-100538079 TGGGGGCTGAGGCGGGCGGCAGG + Exonic
1122444948 14:101761583-101761605 GCGGGGGTGGGGCGAGCGGCGGG + Intergenic
1122540536 14:102495554-102495576 GGGTGGGGAGGCCGGGCGGCTGG + Intronic
1122557898 14:102591634-102591656 AGGGAGGCGGGGCGGGCGGCAGG + Intergenic
1122715753 14:103696095-103696117 TGTGGGGGGGGGCGGGGGGCGGG - Intergenic
1122741853 14:103876002-103876024 TGGGTGGTTGGGCGGGTGGGTGG + Intergenic
1122922042 14:104884316-104884338 TCGGGGCTGGGCCGGGCGGCCGG - Exonic
1123684386 15:22786829-22786851 GGCGAGGTAGGGCGGGCGGCAGG + Exonic
1123798161 15:23794442-23794464 TGGGGAGAAGGGCAGGGGGCTGG + Intergenic
1124426782 15:29570036-29570058 TGGGGGGTGGGGTGGGGGGGCGG - Intronic
1124930445 15:34114604-34114626 TGGCGGGTGGGGCGGGCAGTAGG - Intergenic
1124960476 15:34389692-34389714 TGTGGGGTGGGGAGGGAGGCGGG + Exonic
1124977105 15:34535913-34535935 TGTGGGGTGGGGAGGGAGGCGGG + Exonic
1125300837 15:38252507-38252529 AGGGGGGTGGAGGGGGCGGCGGG - Exonic
1125961682 15:43835299-43835321 TGGGGTGGGGGGCGGGGGGCGGG - Intronic
1126462457 15:48928062-48928084 TGGGGGCTAGGGCGAGCCGAGGG + Intronic
1126680035 15:51193449-51193471 TGGGGGTCAGGGTGGGCAGCTGG - Intergenic
1127537607 15:59904530-59904552 TTGGGGGCGGGGCGGGGGGCGGG + Intergenic
1127892879 15:63270509-63270531 TGGGCGGTGGGGCGGGGGGGGGG + Intergenic
1129618521 15:77120845-77120867 TGGAGGGTAGAGTGGGTGGCCGG - Intronic
1130040904 15:80404565-80404587 TGCGGGCTGCGGCGGGCGGCGGG - Intronic
1130458901 15:84143284-84143306 TGGTAGGTAGGGCAGGCAGCAGG + Intergenic
1130536614 15:84790076-84790098 TGGGGGGTGGGATGGGTGGCGGG - Intronic
1131007503 15:88990442-88990464 TTGGGGGAAGGGCGGGTGGCTGG + Intergenic
1131200059 15:90388464-90388486 TGGGGGCTCGGCCGGGCGGGTGG + Intronic
1131629920 15:94165646-94165668 TGGGGGGCGGGGGGGGGGGCAGG + Intergenic
1132092617 15:98958300-98958322 TTGGGGGTTGGGCAGGGGGCTGG - Exonic
1132184350 15:99791139-99791161 TGCGGGGTGGGGAGGGAGGCGGG - Intergenic
1132431618 15:101766028-101766050 TGTGGGGTGGGGAGGGCCGCCGG + Intergenic
1132552946 16:560752-560774 TGGGGGGCGCGGGGGGCGGCCGG + Intronic
1132578848 16:676047-676069 AGGGAGGGAGGGCGGGCAGCTGG + Intronic
1132642792 16:985317-985339 TGGGGCTGTGGGCGGGCGGCAGG - Exonic
1132696391 16:1204052-1204074 TGGGGGGCTGGGCAGGGGGCAGG - Exonic
1132732103 16:1367607-1367629 TGAGGGGGAGGGAGGGCCGCAGG - Intronic
1132746590 16:1438793-1438815 GGTGGGGCCGGGCGGGCGGCGGG - Exonic
1132761818 16:1512162-1512184 TGGGGGGCAGGATGGGGGGCAGG + Intronic
1132761835 16:1512203-1512225 TGGGGGGCAGGATGGGGGGCAGG + Intronic
1132943554 16:2520243-2520265 TGGGGGCGGGGGCGGGCGGGCGG + Intronic
1133113897 16:3565081-3565103 TGGGGGGCACGGCAGGCAGCAGG - Exonic
1133172956 16:3993001-3993023 TGGGAGTTAGGGCCGGTGGCAGG - Intronic
1133217113 16:4299327-4299349 TGGGGGCTGGGGCGGGTGCCGGG - Intergenic
1133259380 16:4538445-4538467 TGGGCGGTGGGGTGGGCGGTGGG - Intronic
1133896791 16:9937219-9937241 TGGGGGTTGGGGCGGGAGGTGGG + Intronic
1134049366 16:11126152-11126174 TGTGGCGCAGGGCGGGGGGCTGG - Intronic
1134531930 16:14990034-14990056 TGGGGGGTCCGGCGCGCAGCGGG - Intronic
1134588719 16:15434768-15434790 TGGGGCGGGGGGCGGGGGGCCGG + Intronic
1134812944 16:17182689-17182711 TGGGGGGTGGGGTGGGGGGAGGG + Intronic
1135074658 16:19383037-19383059 TGAGGGGTAGGCTGGGAGGCTGG + Intergenic
1135285238 16:21187613-21187635 TGAGGGTTGGGGCGGGGGGCGGG - Intergenic
1135321873 16:21502550-21502572 TGGGGGGGGGGGGGGGGGGCGGG + Intergenic
1135325043 16:21520669-21520691 GGGGGGGTAGGTCGCGAGGCCGG - Intergenic
1135712394 16:24729334-24729356 TGGGGGAGGGGCCGGGCGGCGGG + Intergenic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136336525 16:29613937-29613959 GGGGGGGTAGGTCGCGAGGCCGG - Intergenic
1137531125 16:49279719-49279741 TGGGGGGTGGGGGGGGCGAATGG + Intronic
1138427485 16:56945850-56945872 GGGGGGGTGGGGGGGGCGGGGGG - Intergenic
1138560474 16:57798098-57798120 TGTGGGAAAGGGCGGGCGGCCGG + Exonic
1138677998 16:58665740-58665762 TGGGGAGTAGGGTGGGAGGTGGG + Exonic
1139433961 16:66925675-66925697 TGGCGGGTAGGGCGGGGTGTCGG - Intergenic
1139534476 16:67562900-67562922 GTGGGGGTGGGGGGGGCGGCCGG - Intronic
1139806116 16:69566388-69566410 TGGGGGGTGGGGCGTGGGGGCGG + Intronic
1140087416 16:71809220-71809242 TGGGGGGTAGGGGGGTGGGGGGG + Intergenic
1140458007 16:75115728-75115750 TCGGGGGGAGGGCTGGGGGCTGG + Intronic
1140550066 16:75856079-75856101 TGAGGGGCAGGGTGGGCTGCAGG - Intergenic
1140790493 16:78386621-78386643 TGGGGGGTGGGGCGGGGGGGTGG - Intronic
1141128029 16:81415112-81415134 TCGGGGGGAGGGAGGGCGGGGGG + Intergenic
1141409193 16:83821050-83821072 TGGGTGGGTGGGCGGGCAGCTGG - Intergenic
1141961446 16:87411963-87411985 GCGGGGGTGGGGCGGGCTGCGGG + Exonic
1142128703 16:88422546-88422568 TGGGGGGATGGGCGGGTGGATGG + Intergenic
1142150997 16:88512537-88512559 TGGGGGGCAGGGCGGGGTGGGGG - Intronic
1142299295 16:89247315-89247337 GTGGGGGCAGGGAGGGCGGCGGG + Intergenic
1142313860 16:89330657-89330679 TGGGGGGGGGGGGGGGGGGCGGG + Intronic
1142395239 16:89828298-89828320 TGAGGGGCAGGGCGGGGCGCGGG - Intronic
1142682509 17:1558770-1558792 TGGGGGGGGGGGCGGGGGGGGGG - Intronic
1142810280 17:2392856-2392878 TGGCCGGGAGGGCGGGCGGAAGG + Intronic
1143201236 17:5115182-5115204 TGGGGGGTGGGGCGGTGGGTGGG + Intronic
1143370299 17:6435209-6435231 TGGGGGGAAGGGCAGACGGTGGG + Intergenic
1143461008 17:7103422-7103444 TGGGAGGGAGGGCTGGCAGCAGG - Intronic
1144656827 17:17042421-17042443 CGGGCGGGCGGGCGGGCGGCCGG - Intergenic
1144816988 17:18041196-18041218 CGGGGGGTGGGGCGGGGGGGAGG - Intronic
1146009182 17:29180213-29180235 AGGGAGGGCGGGCGGGCGGCGGG - Intronic
1146009184 17:29180217-29180239 CGGGAGGGAGGGCGGGCGGGCGG - Intronic
1146078735 17:29757782-29757804 TGGGGGGTGGGGTGGGGGGCCGG + Intronic
1146918360 17:36692610-36692632 TGGGGGGAAGGGTGGGAGGAAGG - Intergenic
1147006352 17:37406969-37406991 TGGGCGGGCGGGCGGGCGGGTGG + Intronic
1147037752 17:37694432-37694454 CGGGGGGGGGGGGGGGCGGCGGG - Intronic
1147123733 17:38352023-38352045 AGGGAGGGAGGGCGGGCGGCTGG - Intergenic
1147148106 17:38497885-38497907 TTGGGGGTGGGGCAGGCAGCGGG + Intronic
1147190468 17:38735359-38735381 GGGGAGGTAGGGTGGGTGGCTGG + Exonic
1147341114 17:39753886-39753908 GTGGCGGAAGGGCGGGCGGCGGG - Intergenic
1147420321 17:40319168-40319190 TGTGGGGTTGGGGGGACGGCTGG + Intronic
1147454941 17:40531292-40531314 TTGGGGGTGGGGTGGGTGGCAGG - Intergenic
1147648895 17:42050763-42050785 TGGGGGGTGGGGCCGGGGCCGGG - Intronic
1147757887 17:42780530-42780552 GGGGGGCAAGGGCGGGCCGCGGG + Intergenic
1148048667 17:44758918-44758940 TGGGGGGGCCGGGGGGCGGCGGG + Intergenic
1148095903 17:45052086-45052108 TGGGCGGGAGGGCGGCCGGACGG + Intronic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148736609 17:49868690-49868712 AGGCAGGCAGGGCGGGCGGCGGG - Intergenic
1148769050 17:50056453-50056475 TGGGGCGCGGGGCGCGCGGCTGG - Exonic
1148782751 17:50130648-50130670 TGGGCGGCGGGGTGGGCGGCTGG - Intergenic
1149575062 17:57705997-57706019 TGGGGGGTGGGTGGGGAGGCTGG + Intergenic
1149597813 17:57874550-57874572 AGGGCGGTAGGGCGGGAGCCTGG - Intronic
1149626389 17:58083481-58083503 TGAGGCGGAGCGCGGGCGGCCGG + Exonic
1149848641 17:60022017-60022039 TGAGGGGCAGGGCTGGGGGCGGG + Intergenic
1149861528 17:60124507-60124529 TGAGGGGCAGGGCTGGGGGCGGG - Intergenic
1149994757 17:61400566-61400588 CGGGAGGTAGGGCTGCCGGCCGG + Exonic
1150060573 17:62065345-62065367 GGGTGGGGAGGGCGGGCGCCCGG - Intergenic
1150198301 17:63325060-63325082 TGGGGTGGGGGGCGGGGGGCGGG + Intronic
1150290004 17:63975649-63975671 TGGGGGTTAGGGCAGGGGGGTGG - Intergenic
1151169753 17:72236614-72236636 GGGGGGGCAGGGAGGGAGGCAGG + Intergenic
1151334650 17:73432672-73432694 TGGAGGGGAGGGCTGGGGGCTGG + Intronic
1151386361 17:73757760-73757782 TGGGTGGTGGGGTGGGAGGCTGG - Intergenic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151907451 17:77057711-77057733 TGGGCGGTTGGGGGGGCGGGGGG + Intergenic
1151973065 17:77468960-77468982 TGGGGGATGGGGTGGGAGGCAGG + Intronic
1152008698 17:77697666-77697688 TGGGAGGTGGGGTGGGCAGCAGG + Intergenic
1152024189 17:77798077-77798099 TGCGGGGTAGGGAGGGCCGTGGG - Intergenic
1152197379 17:78925499-78925521 TGGGGGGAGGCGCGGGCGGAGGG - Intergenic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1152589688 17:81205408-81205430 TGGGGGGTAGGAGGGGCAGCGGG + Intronic
1152632307 17:81415758-81415780 TGGGGGGTAGGTCAGGGAGCAGG - Intronic
1152717583 17:81907363-81907385 TGGGAGGGAGGGCAGGCGGGTGG - Intronic
1152718587 17:81911521-81911543 CGGGGCGGAGGGCGGGAGGCGGG - Intergenic
1152759087 17:82098880-82098902 TAGGGTGATGGGCGGGCGGCGGG + Intergenic
1152831110 17:82497459-82497481 TGGGTGGGAGGGAGGTCGGCGGG - Intergenic
1152831122 17:82497485-82497507 TGGGTGGGAGGGAGGCCGGCGGG - Intergenic
1152851602 17:82639784-82639806 TGTGGGGTCGGGAGGGCTGCTGG + Intronic
1153285200 18:3450105-3450127 AGGGGGACGGGGCGGGCGGCTGG + Intronic
1153320813 18:3772430-3772452 TGGGGGGGAGGGAGGGAGGGAGG - Intronic
1153515201 18:5895571-5895593 GAGGGGGTGGGGCGGGGGGCGGG - Intronic
1153564268 18:6404091-6404113 TGGGGGGAAGGGTGGGAGGAGGG + Intronic
1154123343 18:11669455-11669477 TGGGGTCTGGGGCGGGTGGCTGG + Intergenic
1154163753 18:11998922-11998944 GGGGGGGGGGGGGGGGCGGCGGG - Intronic
1156350363 18:36297470-36297492 GGGCGGGGAGGCCGGGCGGCCGG - Intergenic
1156458507 18:37308092-37308114 TGAGGGGTTGGGCAGGGGGCAGG - Intronic
1157095135 18:44680318-44680340 TGGGGGCTCGGGCGAGCGACGGG + Intronic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1160163240 18:76491332-76491354 CGGGGGGAAGGGCAGGCCGCGGG - Intronic
1160272971 18:77404172-77404194 TGGGGGCTGGGGCGGGCAGAAGG - Intergenic
1160579054 18:79873412-79873434 GGGGGGGGAGGGGGGCCGGCAGG - Intronic
1160579055 18:79873416-79873438 TGGGGGGGGGGGAGGGGGGCCGG - Intronic
1160692123 19:464997-465019 TGGGTGGGAGGGTGGGCGGATGG + Intronic
1160771901 19:835730-835752 TGGGGGGTGTGGAAGGCGGCCGG + Intergenic
1160902424 19:1435011-1435033 TGGGGGGGGGGGCGGGGGGAGGG + Exonic
1161072809 19:2270894-2270916 GGGGCGGGGGGGCGGGCGGCCGG + Intronic
1161079332 19:2302776-2302798 AGGGGGGCCGGGCCGGCGGCAGG + Intronic
1161114587 19:2489401-2489423 CGGGGCGTGGGGCGGGCGGCCGG - Intergenic
1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG + Intronic
1161258628 19:3323392-3323414 TGGGGTGTGGGGCGGGGGGCGGG - Intergenic
1161392546 19:4028861-4028883 TGGGGGGCAGGGTGGGCACCCGG - Intronic
1161582923 19:5090642-5090664 TGGGGGGAAGGGGGGGCCGGAGG - Intronic
1161594538 19:5144419-5144441 TGTGGGGTGGGGCAGGGGGCGGG + Intronic
1161620184 19:5293363-5293385 TGGGGGGCAGGGCGGGGCCCCGG + Intronic
1161688948 19:5719821-5719843 CGGGGGGCAGCGCGGGCGCCGGG - Exonic
1161698648 19:5783682-5783704 TGGGGGGTGGGGGTGGCAGCGGG + Exonic
1162027757 19:7904084-7904106 TGGGGGAGGGGGCGGGCGGGCGG + Intronic
1162111848 19:8403795-8403817 GGCGGGGTGGGGAGGGCGGCAGG + Exonic
1162319636 19:9963561-9963583 TGGGGGGGGGGGCGGGTGGAGGG + Intronic
1162738956 19:12763125-12763147 TGGTGGGGAGGGAGGGCGGGAGG - Exonic
1162821520 19:13226255-13226277 GGGGGGGGGGGGGGGGCGGCAGG + Intronic
1162954629 19:14091089-14091111 GGGCGGGCAGGGCGGGCGGGCGG + Intergenic
1163075517 19:14887479-14887501 TGGGGGGTGGGGTGGGGGGGAGG - Intergenic
1163407470 19:17131883-17131905 TGGGGGGTGGGGCGGGGAACAGG + Intronic
1163424965 19:17236114-17236136 GGGGGGGGGGGGCGGGCAGCAGG + Intronic
1163630958 19:18417704-18417726 TGGGGGAAGGGGCGGCCGGCTGG + Intergenic
1163664736 19:18598061-18598083 GGGGGCGCAGGGCGGGAGGCAGG - Intronic
1163701469 19:18788785-18788807 CGGGAGGTGGGGCGAGCGGCGGG - Intronic
1164810258 19:31149561-31149583 TGGGCGGGCGGGCGGGCGGGTGG - Intergenic
1164825268 19:31280460-31280482 TGGGGGACAGGGCTGGGGGCTGG - Intronic
1164830205 19:31314308-31314330 TGGGAGAGAGAGCGGGCGGCAGG + Intronic
1165246387 19:34500636-34500658 CGGGGGGGAGGGCGGGGGCCAGG - Exonic
1165325370 19:35111542-35111564 GGGGGGGGGGGGCGGGCTGCAGG + Intergenic
1165780889 19:38433747-38433769 TGGGCGGGAGGGCTGGGGGCGGG - Intronic
1165924926 19:39320900-39320922 CGGGAGGGAGGGCGGGAGGCGGG - Intergenic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166799976 19:45450884-45450906 TGGGGGGGGGGGGGGGGGGCGGG - Intronic
1166882947 19:45940223-45940245 TCGGGGCCGGGGCGGGCGGCGGG - Exonic
1167506012 19:49871509-49871531 GGGGAGGTAGGGAGGGCAGCTGG - Intronic
1167622923 19:50568797-50568819 GGGAGGGGAGGGCGGGGGGCAGG + Intergenic
1168029288 19:53666783-53666805 TGGGGGGGAGGGGGGGCGGGGGG + Intergenic
1168029624 19:53669267-53669289 TGGGGGGGAGGGGGGGCGGGGGG + Intergenic
1168076533 19:53983165-53983187 TGGGGGGCGGGGCGGGGGGAGGG + Exonic
1168144983 19:54415700-54415722 TGGGGGCCAGGGCTGGGGGCCGG + Intronic
1168294157 19:55370494-55370516 AGGGGGCTGGGGCGGGCGGGCGG + Intergenic
1168316859 19:55488379-55488401 TGGGGGGGAGGGGGGGCGGGAGG - Intergenic
1168317053 19:55489052-55489074 TGGGGGGGGGGGCGGGCAGATGG - Intronic
1168400544 19:56083777-56083799 TGGGGGGTGGGGTGGGGGGGGGG + Intergenic
1168543574 19:57231979-57232001 TGGGAGGTAGGGTAGGCGGAGGG - Intronic
1168558318 19:57362265-57362287 TGGGGGGCAGGGGGCGCGGCGGG - Intergenic
925589461 2:5494942-5494964 GGGGGTGTAGGGTGGGAGGCAGG - Intergenic
925929293 2:8694172-8694194 TGGGGGGCAGGGGAGGGGGCTGG + Intergenic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
927692004 2:25215229-25215251 TGGGGAGGAGGGCAGGCGGTGGG - Intergenic
927708295 2:25310469-25310491 TGGCGGGTAGGGCAGGCGGCAGG + Intronic
927713958 2:25341213-25341235 CGGGGGGAGGGGCGGGGGGCCGG + Intronic
927846365 2:26474439-26474461 TGGGGCCTAGGGCTGGGGGCTGG - Intronic
927881417 2:26692606-26692628 TGGGCGGGAGGGCTGGCGGGAGG + Intergenic
928143956 2:28754337-28754359 TGGGGGGGCGGGGGGGGGGCGGG + Intronic
928164991 2:28964631-28964653 TGGGGGGTTGGGTGGGGGGAGGG - Intronic
928175069 2:29027910-29027932 TGGGGGTGAGGGTGGGCAGCAGG + Intronic
928256645 2:29728680-29728702 AGTGGGGTAGGGTGGGAGGCTGG + Intronic
928394910 2:30936165-30936187 TGGGGGGAATGGAGGGCGGGAGG - Intronic
928436414 2:31257354-31257376 AGGGGAGTAGTGCGGGCTGCAGG + Intronic
928709783 2:33990931-33990953 TGGGGGGAGTGGCGGGCGGTAGG + Intergenic
929151236 2:38750924-38750946 GGGGGGGGAGGGGGGCCGGCGGG + Intronic
929231301 2:39563327-39563349 CAGGGGGTTGGGCGGGGGGCTGG - Intergenic
929775690 2:44929416-44929438 TGGGGTGGAGGGCGCGGGGCTGG + Intergenic
929906949 2:46054781-46054803 TGGGGGGTGGGGCGGGCCATGGG - Intronic
930096964 2:47572233-47572255 TGGGCGGTAGGGCAGGGGGCAGG - Intergenic
930124349 2:47783891-47783913 TGGTGGGCGGGGCGGGGGGCGGG + Intronic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
930700673 2:54456256-54456278 TGGGCGGGAGCGCGGGGGGCGGG - Intergenic
930989311 2:57631575-57631597 TGGGGTGGGGGGCGGGAGGCAGG + Intergenic
931038454 2:58269074-58269096 GGGGGGGTAGGGCGGGCGGGGGG - Intergenic
931438193 2:62267018-62267040 TGGGGGGTTGGGGGGGCAGTAGG + Intergenic
931440675 2:62288033-62288055 TGAGGGGTGGGGCTGGTGGCAGG + Intergenic
931671561 2:64653361-64653383 TGGGGGGCAGGGCCGGGGTCAGG - Intronic
931881573 2:66575853-66575875 AGGGGGATCGAGCGGGCGGCCGG + Intergenic
932495360 2:72143420-72143442 GTGGGGGAAGGGCGGGCGGGGGG - Intronic
934522005 2:95025606-95025628 CGGGGCGTGGGGCGGGGGGCGGG + Intergenic
934971831 2:98770342-98770364 GGGGGGGGGGGGCGGGGGGCAGG - Intergenic
935095712 2:99942535-99942557 TGGGGGGAGGGGCGGGGGGGGGG + Intronic
935104444 2:100026925-100026947 TGGGGGGAAGGGTGGGAGGGTGG + Intronic
935237613 2:101151498-101151520 TCGGGGGCGGGGCCGGCGGCTGG - Intronic
935282920 2:101534557-101534579 AGGGGGGTAGGGAGGGCAGGTGG + Intergenic
935645269 2:105329522-105329544 TGGGGGGTAGGCGGCGGGGCGGG - Intronic
935945676 2:108284549-108284571 TGTGGGGTAGCGGGGGCGGAGGG - Intergenic
936155767 2:110046621-110046643 TGAGGGGCAGGGCTGGCAGCTGG + Intergenic
936280086 2:111131232-111131254 TGGGGGGGATGGGGGGCGGGCGG + Intronic
936510356 2:113140187-113140209 TGGGGGGAAGGGTGGGTGGGGGG - Intergenic
936954790 2:118013468-118013490 AGGCGGGTGGGGCGGGCCGCCGG + Intronic
937059453 2:118970697-118970719 TGGGTGGTAGGGCTGCAGGCTGG + Intronic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937283352 2:120735498-120735520 TGGGAGGTGGGGAGGGCGGGGGG + Intergenic
937478240 2:122234149-122234171 GGGGCGGGGGGGCGGGCGGCGGG + Intergenic
938034865 2:128027619-128027641 CGGGCGGGCGGGCGGGCGGCCGG - Intronic
938042853 2:128090450-128090472 TGGGGGGTGGGGGGCGCGGGCGG + Intergenic
938100271 2:128493438-128493460 TGGGGGGTTGGGCGGGGCGGGGG + Intergenic
938796121 2:134719183-134719205 TGGGGGCAGGTGCGGGCGGCAGG + Intergenic
939160521 2:138583177-138583199 TGGGGGGTAGGGCAGTTGGTGGG + Intergenic
939981330 2:148785325-148785347 TCGGGGGTGGGGCGGGCAGTGGG - Intronic
941430992 2:165413999-165414021 TGAGGGGAAGGGTGGGAGGCAGG - Intergenic
941869622 2:170370599-170370621 TGGGTGGTAGGGGTGGTGGCTGG - Intronic
941905841 2:170715887-170715909 TGGGAGGGAGAGCGGCCGGCCGG + Intronic
942240784 2:173963656-173963678 TCGGGGGAAGCGCGGGCGCCGGG + Intronic
942363735 2:175199759-175199781 TGGGCGGTGGGGGGGGGGGCAGG + Intergenic
942656750 2:178221753-178221775 TGGGGAGTAGGGAGGAGGGCTGG + Intronic
943973135 2:194437146-194437168 TGGGGGTAAGGGTGGGCGGGGGG - Intergenic
945116297 2:206411049-206411071 TGGGGCGGAGCGCGGGAGGCCGG - Intergenic
945227658 2:207548752-207548774 TGGGGGGGAGCGGGGGAGGCAGG - Intronic
945559889 2:211326807-211326829 TGGGGGTGAGGGCGGGGGTCAGG - Intergenic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946113398 2:217439846-217439868 TGGGTGGTGGGGTGGGGGGCGGG - Intronic
946248502 2:218400032-218400054 CGGGGGGGAGGCCGGGCGCCCGG + Exonic
946405251 2:219488917-219488939 TGGAGGGTTGGGGGAGCGGCAGG + Intronic
947418507 2:229921802-229921824 TGAGGGGTTGGGGGGGCGGGGGG - Intronic
947524126 2:230868244-230868266 AGGGGGGGAGGCCGGGCAGCTGG - Intronic
947611896 2:231530048-231530070 CGGGGGTGAGGGCGGGCGGGAGG - Intronic
947740616 2:232483230-232483252 TGGTGGGTAGGGTGGGGGGCGGG - Intronic
948019002 2:234714966-234714988 TGGGAGGTAGGGAGGGCTGAGGG + Intergenic
948129747 2:235591841-235591863 TGGGGGGTGGGGGTGGGGGCAGG - Intronic
948402167 2:237692148-237692170 TGGGGGGCGGGGCGGGCCGTGGG + Intronic
948601718 2:239111343-239111365 TGGGGTGTAGGGCGGGGAGAGGG + Intronic
948815914 2:240510264-240510286 TGGGGAGGAGGGCAGGAGGCAGG - Intronic
1169193869 20:3673322-3673344 TGGGGGGTCGGGGCTGCGGCGGG - Intronic
1169225562 20:3854501-3854523 TGGGGGGTTGGGAGTGGGGCTGG - Intronic
1170304555 20:14923788-14923810 TTGGGGGAGGGGGGGGCGGCGGG + Intronic
1170664028 20:18370186-18370208 TGGGGGGGGGGGCGGGGGGAGGG + Intergenic
1171010842 20:21508701-21508723 TGCGGGGTGGGGCGGGGGGTGGG + Intergenic
1171567597 20:26209086-26209108 TGGGGGGGGGGGTGGGAGGCGGG - Intergenic
1171866938 20:30492903-30492925 TGGGGGGGAGGGGGGTGGGCGGG + Intergenic
1171942622 20:31346773-31346795 AGGGGGGTAGGGGGTGGGGCAGG - Intergenic
1171973399 20:31578669-31578691 GGGGGGGCATGGCGGGCTGCAGG + Intergenic
1172118282 20:32584085-32584107 TGGGGGGGGGGGAGGGAGGCAGG - Intronic
1172592075 20:36124923-36124945 TGGTGGGTAGGGGAGGCAGCGGG + Intronic
1172754416 20:37273218-37273240 TGGGGGTTTGGGGGGGCGGTGGG + Intergenic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172840789 20:37901882-37901904 TGGGGCGGGGGGCGGGGGGCGGG + Intergenic
1173214195 20:41064871-41064893 TCTGGGGTGGGGCGGGGGGCTGG + Intronic
1173618132 20:44416126-44416148 TGGGGGGTGGGCCGGGAGGTCGG - Intronic
1174014600 20:47477639-47477661 TGGGGGGATGGGTGGGGGGCAGG - Intergenic
1174548208 20:51342264-51342286 TGGGGGGTTGGAGGGGCGCCGGG + Intergenic
1174593879 20:51668086-51668108 TGGGGGGGGGGGGGGGCGGAAGG + Intronic
1174595160 20:51678122-51678144 TGGGTGGCAGGGCGGGGGGAAGG + Intronic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1175217342 20:57398539-57398561 TGGGGGGGCAGGGGGGCGGCGGG - Intronic
1175224837 20:57439133-57439155 TGTGGGGCAGGGCAGGAGGCTGG - Intergenic
1175260487 20:57670901-57670923 TTGGGGGTTGGGGGGGCGGTGGG - Intronic
1175521401 20:59604597-59604619 TGGGGGGTGGGGTGGGGGGAGGG + Exonic
1175678500 20:60967430-60967452 TGCGGGGTTGGGCGGTCGGAGGG + Intergenic
1175678511 20:60967470-60967492 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678523 20:60967510-60967532 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678535 20:60967550-60967572 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678547 20:60967590-60967612 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678557 20:60967630-60967652 TGCGGCGTTGGGCGGGCGGAGGG + Intergenic
1175678568 20:60967670-60967692 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175873397 20:62218823-62218845 TGGGGGTGAAGGCTGGCGGCAGG - Intronic
1175973065 20:62696851-62696873 TGGGGGGTGGGGTGGGGGGTGGG + Intergenic
1176142071 20:63549188-63549210 TGGGGGGAGGAGAGGGCGGCGGG - Intronic
1176206201 20:63889544-63889566 CCGGGGGTAGGGCGGGAGGAAGG - Intronic
1178584584 21:33861393-33861415 TGGGGGGTGGGGCAGGGGGTAGG + Intronic
1178610342 21:34073867-34073889 CGGGGCGGCGGGCGGGCGGCGGG + Intronic
1178843328 21:36155968-36155990 TGGGGCGCAGGGGGCGCGGCGGG - Intergenic
1178893894 21:36543091-36543113 TGCGGTGTAGGGTGGGAGGCGGG - Intronic
1179139621 21:38713077-38713099 TGGGGGGAGGGGGGGGCGGGGGG + Intergenic
1179218583 21:39387665-39387687 TGGGGAGTAGGGGGGGTGGAGGG - Intronic
1179321063 21:40291584-40291606 TTGGGGGTAGGGGGCGAGGCCGG - Intronic
1179573497 21:42292113-42292135 TGGGCGGCAGGTCGGGGGGCAGG - Intronic
1179624511 21:42641226-42641248 CGGGGGGGGGGGCGGGGGGCGGG - Intergenic
1179626772 21:42653549-42653571 GGGAGGGGCGGGCGGGCGGCCGG + Intergenic
1179801928 21:43815231-43815253 CGGGGGGGAGGGGGGGCGACCGG + Intergenic
1179810551 21:43866383-43866405 TGGGAGGTGGGGCGGGCGGCGGG + Intronic
1179951076 21:44709099-44709121 TGGGGGGCTGGGTGGGAGGCTGG - Intronic
1180009715 21:45041356-45041378 TGGGGGGTTGGTGGGGGGGCGGG - Intergenic
1180074740 21:45456730-45456752 AGGGTGGCGGGGCGGGCGGCGGG - Intronic
1180085387 21:45505784-45505806 TGGCGGGGAGGGCGGGGGGCAGG - Intronic
1180699615 22:17774270-17774292 TCGGGCCCAGGGCGGGCGGCGGG + Intronic
1180742636 22:18064482-18064504 TGGGGGCTGGGGTGGGAGGCGGG + Intergenic
1181125985 22:20702749-20702771 GGTGGGGCAGGGCGGGCGGAAGG + Intergenic
1181165347 22:20980196-20980218 TGGAGGGTTGTGGGGGCGGCTGG - Intronic
1181239322 22:21468057-21468079 GGTGGGGCAGGGCGGGCGGAAGG + Intergenic
1181470742 22:23137777-23137799 TGGGGGGTGGGGACGGGGGCTGG + Intronic
1181809588 22:25395306-25395328 TGGAGGGGAGGGTGGGGGGCAGG + Intronic
1182355263 22:29719949-29719971 GGAGGGGGCGGGCGGGCGGCTGG + Intergenic
1182858807 22:33541056-33541078 GGGGGGGGGGGGCGGGGGGCGGG + Intronic
1183341659 22:37284939-37284961 TGGGGCGGTGGGGGGGCGGCGGG + Intronic
1184086907 22:42270711-42270733 CGGGCGGGAGGGCGCGCGGCGGG + Intronic
1184484227 22:44766229-44766251 TGTGGGGCGGGGCGGGCAGCAGG + Intronic
1184688514 22:46107179-46107201 CGGGGGCTAGGACGGGAGGCGGG - Intronic
1184916723 22:47574548-47574570 TGGGGGGTGGGTGGGGCAGCAGG + Intergenic
1185170622 22:49291690-49291712 TGGGGGGTAGTGGGTGGGGCAGG - Intergenic
1185297639 22:50062161-50062183 TGGGGCTTAGGGTGGACGGCTGG - Intronic
1185297660 22:50062221-50062243 TGGGGCTCAGGGTGGGCGGCTGG - Intronic
1185297688 22:50062301-50062323 TGGGGCTCAGGGTGGGCGGCTGG - Intronic
1203247491 22_KI270733v1_random:85026-85048 TGGGGGGGAGGGAGGTGGGCGGG - Intergenic
950176223 3:10876741-10876763 TGGGAGGTGGGGCGGGGGGGGGG - Intronic
950671050 3:14525590-14525612 TGGGGGCTTGAGCGGGCAGCTGG + Intronic
952426050 3:33175162-33175184 TTGAGGGTACGGTGGGCGGCAGG - Intronic
952784255 3:37136965-37136987 TGGGGGGGTGGGGGGGGGGCGGG + Intronic
952788337 3:37176925-37176947 TGGGGGGGGGGGCGGGGAGCGGG + Intronic
952816786 3:37453109-37453131 TGGGGGGGGGGGGGGGCGCCGGG - Intronic
952833870 3:37588307-37588329 TGGGGGGGTGGGCTGGGGGCTGG - Intronic
952969281 3:38640826-38640848 TTGGGGGTGGGGCTGGGGGCGGG + Intronic
953387784 3:42516420-42516442 TGGGGTGTAGGGCAGCCAGCAGG - Intronic
953752515 3:45619818-45619840 TGGGGGGGGGGGCGGGGGGTTGG - Intronic
953979149 3:47405097-47405119 TGGGGAGTAGGGCCGGGGGAAGG - Intronic
954313193 3:49786194-49786216 TGGGAGGCTCGGCGGGCGGCCGG + Exonic
954373553 3:50182880-50182902 TGGGGGGTGGGGCAAGAGGCCGG - Intronic
954479271 3:50782781-50782803 TGGGGGGAAGGGTGGGAGGTGGG - Intronic
954563571 3:51579281-51579303 TGGGGGGCAGGGCGGGCCATGGG + Intronic
954582296 3:51709454-51709476 TGGGGGCTAGGGAGGGAGGCCGG + Intronic
955320680 3:57972178-57972200 TCAGGGGCAGGGAGGGCGGCTGG + Intergenic
955911710 3:63864309-63864331 TGGGGGGTGGGGAGGGTGACGGG + Intergenic
956121858 3:65974368-65974390 TGGGCGGGTGGGCGGGTGGCTGG + Intronic
956500360 3:69876421-69876443 TGAGGGGCATGGCGGGTGGCGGG - Intronic
957763934 3:84596371-84596393 TTGGGGGAAGGGTGGGAGGCGGG - Intergenic
958942073 3:100327753-100327775 TGGGGTGCAGGGCGGGGGGAGGG + Intergenic
961519319 3:127457420-127457442 AGTGGGGAAGGGCAGGCGGCGGG + Intergenic
961612583 3:128152922-128152944 CGGGGGGGAGGGCGGGGGGACGG - Intronic
962170234 3:133094211-133094233 TGGGGGGTGGGGTGGGAGGTGGG - Intronic
962322834 3:134405972-134405994 CGGGGGGGTGGGGGGGCGGCGGG + Intergenic
963502552 3:146146496-146146518 TGGGGAGGAGGGCGGGTGGACGG + Intronic
965473892 3:169130462-169130484 GGAGGGGGAGGGCTGGCGGCGGG - Intronic
965657462 3:171003441-171003463 TGGGGGGGAGGGTGGGAGGCGGG + Intronic
965757550 3:172040655-172040677 CCGGGGATAGGGCGGGCGGGCGG + Intronic
966854721 3:184186135-184186157 TCGGGGGCAGGGCGGGGGGCGGG + Exonic
966935905 3:184709338-184709360 TCGGGGGCAGGGTGGGCGGATGG - Intergenic
967046238 3:185739846-185739868 TGGGGGGTAGGGGGGGTGGGGGG - Intronic
967273108 3:187746893-187746915 TGGGGGGTGGGGTGGGGGGGGGG + Intergenic
967336207 3:188347582-188347604 GGGGGGGTAGGCCGGGAGGAGGG - Intronic
968512508 4:1001836-1001858 TGGGGAGGCGGGCGTGCGGCTGG + Exonic
968815331 4:2818669-2818691 GGCGCGGTTGGGCGGGCGGCGGG + Intronic
969559839 4:7939886-7939908 GGGGCGGGACGGCGGGCGGCGGG - Exonic
969737488 4:9001115-9001137 CGCGGGGTAGGGTGGGCGGGAGG + Intergenic
969846218 4:9922316-9922338 TGGGGGGTGGGGTGGGGGGAGGG + Intronic
969906675 4:10403539-10403561 TGGGAGGTAGGGCGGAAGGCTGG + Intergenic
970754878 4:19413862-19413884 GGGGGGGGGGGGCGGGCGGGGGG - Intergenic
971622635 4:28875346-28875368 TGGGGGGAAGGGTGGGTGGGGGG - Intergenic
973017954 4:45165341-45165363 TGTGGGGTTGGGAGGGAGGCGGG - Intergenic
974505867 4:62771735-62771757 TGGGGGGTGGGGCGGGCAATGGG - Intergenic
974586297 4:63883071-63883093 TGGGGGGTGGGGAGGCGGGCAGG - Intergenic
974715801 4:65668727-65668749 TTGGGGGTAGGGAGGGGGACTGG + Intronic
975613636 4:76224897-76224919 TGGGGGGAAGGGTAGGAGGCGGG - Intronic
975614921 4:76236685-76236707 TGGGGGGTGGGGTGGGGGTCAGG + Intronic
976207675 4:82638266-82638288 GGGGGGGCAGGGCAGGGGGCGGG - Intronic
976222615 4:82770175-82770197 TGGGGTGTGGGGAGGGGGGCAGG - Intronic
976447025 4:85141789-85141811 TGGGGGGTGGGGGGGGGGGGGGG - Intergenic
977023390 4:91786166-91786188 TGGGGTGGAGGGAGGGCGGAGGG - Intergenic
978776370 4:112510186-112510208 TGGGGGGGGGGGCGGGGGGCGGG + Intergenic
978871236 4:113580911-113580933 TGTGGGGTAGGGTGGGGGGAGGG + Intronic
979193394 4:117890857-117890879 CCGGGGGTGGGGTGGGCGGCAGG + Intergenic
979491688 4:121335571-121335593 TGGGGGGTGGGGGGTGGGGCGGG + Intronic
981745631 4:148049828-148049850 TGGGTGGGGGGGCGGGGGGCGGG + Intronic
982564491 4:156971398-156971420 TGGGGGGTGGGGCGGGGGAGAGG - Intergenic
982573213 4:157076167-157076189 TCGGCGGTGGCGCGGGCGGCTGG + Exonic
982702327 4:158671360-158671382 TGAGGGGTGGGGCGGGTGGAAGG + Intronic
983247001 4:165298933-165298955 GGGGGGGGAGGGGGGGCGGGGGG - Intronic
983576972 4:169270842-169270864 CGCGAGGTAGGGCGCGCGGCCGG - Exonic
983893919 4:173061152-173061174 TGGGGGGAAGGGTGGGAGGGAGG - Intergenic
984345687 4:178521847-178521869 TGGGGGGAAGTGCGGGAGGGAGG - Intergenic
984492174 4:180448594-180448616 TGGGGCCTAGGGCAGGAGGCTGG + Intergenic
984670911 4:182486315-182486337 TGGGGGGGAGGGTGGGTGGGTGG + Intronic
984769759 4:183427194-183427216 TGGGGGGGGGGGCGGGGGGTGGG + Intergenic
985122968 4:186662011-186662033 TGGGGGGCTGGCCGGGGGGCGGG - Intronic
985484299 5:140154-140176 TGGGGGGTCGGGGGAGAGGCCGG + Intergenic
985516522 5:348085-348107 TGTGGGGGAAGCCGGGCGGCCGG + Intronic
985621643 5:959270-959292 TGGGGGGCAGGGCTGGGGGTGGG - Intergenic
985629973 5:1009100-1009122 AGGGCGGGAGGGCGGGCGGGCGG + Intronic
985632486 5:1021352-1021374 TGGGTGGAGGGGCGGGGGGCCGG - Intronic
985645674 5:1083694-1083716 TGGGGGGTGGCGGGGGCAGCAGG - Intronic
985790811 5:1926137-1926159 TGGAGGGCAGGGCTGGCTGCAGG - Intergenic
985837017 5:2278937-2278959 TGGTGGGAGCGGCGGGCGGCGGG + Intergenic
985867074 5:2522444-2522466 TTGGGAGAGGGGCGGGCGGCAGG + Intergenic
987220346 5:15784556-15784578 TGGGAGGTGGGTCGGGGGGCGGG + Intronic
989011425 5:36876820-36876842 GGGGGGGGAGGGCGGGGGGAAGG - Exonic
990249492 5:53898646-53898668 TCGGGGGTAGGGGGGGCAGCGGG - Intronic
990287283 5:54312100-54312122 TGAGGGTTTGGGCGGGGGGCGGG + Intergenic
990311563 5:54544027-54544049 TAGGGGGTGGGGGGGGCGGTGGG + Intronic
990756218 5:59073500-59073522 TGGGGGGCGGGGGGGGCGGGTGG + Intronic
991533389 5:67639421-67639443 AGGGGGGTGGGGCGGGGTGCTGG - Intergenic
991584206 5:68186168-68186190 GGGGCGGTGGGGCTGGCGGCAGG - Intergenic
992077176 5:73202241-73202263 AGGGAGGGAGGGAGGGCGGCAGG + Intergenic
992716353 5:79514363-79514385 TGGGGAGCTGGGCCGGCGGCAGG + Intergenic
993265482 5:85721612-85721634 TGGGAGGTGGGGGGGGCGGGGGG + Intergenic
993384688 5:87251036-87251058 CGGGGGGTGGGGGGCGCGGCAGG - Intergenic
993384693 5:87251048-87251070 TGGGGGGTGGCGCGGGGGGTGGG - Intergenic
993457377 5:88141751-88141773 TGGGGGGTGGGGGCGGGGGCGGG - Intergenic
993733083 5:91445647-91445669 GGGGGGGGGGGGGGGGCGGCAGG - Intergenic
993930684 5:93935078-93935100 TGGGGGAAAGGGTGGGAGGCGGG + Intronic
993989705 5:94641175-94641197 GGGGGGGTGGGGCGGGCGGGAGG - Intronic
994184980 5:96807404-96807426 GGCGGGGTGGGGCGGGCAGCTGG - Intronic
994457192 5:100025702-100025724 TGGGGGGGGGGGCGGGGGGCAGG + Intergenic
994509010 5:100679525-100679547 TGGGGGGTGGGGTGGGTGGGAGG + Intergenic
995872275 5:116756052-116756074 TGGGGGGTGGGGGGGTTGGCAGG - Intergenic
995923168 5:117338395-117338417 TGGGGTGGAGGGCGGGGGGAGGG - Intergenic
996770727 5:127082613-127082635 TGGGGGTTGGGGAGGGTGGCGGG + Intergenic
997645201 5:135477412-135477434 TGGGGGGGTGGGCAGGGGGCGGG - Intergenic
997903878 5:137794979-137795001 GGGGGGGAGGGGCGGGGGGCGGG + Intergenic
998026409 5:138820024-138820046 TGGGGGGCAGGGCGGGGGGTGGG - Intronic
998093293 5:139383178-139383200 TGGGGGCTAGGGGGGGCAGGGGG - Intronic
998132365 5:139657871-139657893 AGGGAGGGAGGGCGGGCGTCAGG - Intronic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
999043758 5:148445354-148445376 TGGCGGGGGGGGCGGGGGGCGGG + Intergenic
1000805768 5:165789548-165789570 TGGGAGGCCGGGCGGGGGGCGGG - Intergenic
1000937612 5:167321801-167321823 TGGGGGGGGGGGCGGGGGGGGGG + Intronic
1001292348 5:170472575-170472597 TGGGGGGGAGGGTGGGAGGGGGG - Intronic
1001544107 5:172559218-172559240 TGGGGGGTGGAGGGGGCGGGTGG + Intergenic
1001773402 5:174311979-174312001 AGGAGGGAAGGGCTGGCGGCAGG + Intergenic
1002013888 5:176305591-176305613 GGGGGGGTTGGCCGGGCGGAGGG - Intronic
1002260788 5:177992760-177992782 TGGGGGGCAGGGCAGATGGCCGG + Exonic
1002452425 5:179326475-179326497 TGGGGGGCGGGGCCGGGGGCGGG - Intronic
1002466655 5:179411997-179412019 TGGGGGGGAGGGTGGAAGGCCGG - Intergenic
1002467015 5:179412826-179412848 TGGGGGGGAGGGTGGAAGGCCGG - Intergenic
1002524410 5:179807159-179807181 CGGGGCGGGGGGCGGGCGGCGGG + Intronic
1002564345 5:180101354-180101376 GGGGGGGGGGGGCGGGCAGCAGG + Exonic
1002715275 5:181223384-181223406 CGGGGGGTAGGGGGAGCGCCTGG - Exonic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1002928993 6:1620567-1620589 AGGGGGCGAGGGTGGGCGGCCGG + Intergenic
1003085194 6:3054781-3054803 TTGGGGGTTGGGAGGGCGGTGGG + Intergenic
1003362166 6:5438236-5438258 TGGGGGGGGGGGCGGGGGGTGGG - Intronic
1004409387 6:15366502-15366524 TGGGGGGCGGGGGGGGCGGGGGG + Intronic
1004562248 6:16761547-16761569 AGGGAGGGAGGGCGGGCGGGCGG - Intergenic
1004905716 6:20235341-20235363 TGGGGGGTGGGGGGGGGGACGGG + Intergenic
1005414183 6:25583831-25583853 TGGGTTGTTGGGCGGGAGGCGGG - Intronic
1005511749 6:26517968-26517990 TGGGGGGTAGGGGGGTGGGGAGG + Intergenic
1006366907 6:33621362-33621384 GGGCGGGGCGGGCGGGCGGCGGG + Exonic
1006642569 6:35496685-35496707 GGGGGGGTGGGGAGGGCGGGGGG + Intronic
1006642571 6:35496689-35496711 GGGTGGGGAGGGCGGGGGGCGGG + Intronic
1006722569 6:36167115-36167137 TGGGGGGAAGAGCGGGAGGGAGG + Intergenic
1007323913 6:41046050-41046072 GTGGGGGTAGGGGTGGCGGCAGG - Intronic
1007421246 6:41721009-41721031 TGGGGGCTGGGGCTGGGGGCTGG - Intronic
1007435304 6:41806286-41806308 CGTGAGGTAGGGAGGGCGGCGGG + Exonic
1007903425 6:45434038-45434060 TGGGGGGTAGGGGGAGTGGGTGG + Intronic
1007957418 6:45930137-45930159 TGGGGGGTAGGTGGGGAGGAGGG - Intronic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1009899688 6:69796646-69796668 TGGGGGCTTGGGCGGGCGGCGGG - Intronic
1010582505 6:77616908-77616930 TGGGGGGTAGGGGGAGGGGGAGG + Intergenic
1011250314 6:85364933-85364955 TGGGGAGTGGGGCGGGGGGAGGG - Intergenic
1011664739 6:89623015-89623037 TGGGGGGTGGGGGGGGCGGGAGG + Intronic
1011734441 6:90297035-90297057 CGGGGGCTGGGGCGGGGGGCGGG + Intergenic
1012202990 6:96429084-96429106 TGGGGGGTGGGGTGGGTGGGAGG - Intergenic
1012342959 6:98151599-98151621 TGGGGGGCGGGGTGGGAGGCTGG - Intergenic
1012821822 6:104093663-104093685 TGTGGGGTGGGGCGGGGGGAGGG + Intergenic
1013117686 6:107115147-107115169 TGGGGGGGAGGGCGCGGGGCCGG + Intronic
1013509987 6:110835859-110835881 TGGGGGGTGGGGTGGGGGGATGG - Intronic
1013576017 6:111483730-111483752 GGGAGGGAAGGGCGGGCGGGCGG + Intergenic
1013647530 6:112160234-112160256 TGCGGGGAAGGGCTGGGGGCTGG - Intronic
1014078602 6:117264904-117264926 TGGGGTGTGGGACAGGCGGCGGG + Intergenic
1016034464 6:139372505-139372527 ATGGGGGTGGGGGGGGCGGCGGG + Exonic
1017447352 6:154518785-154518807 GGGGGGGTGGGGTGGGGGGCGGG - Intergenic
1017708640 6:157147352-157147374 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1017708827 6:157147832-157147854 TGGCGGGCAGGGCCGGAGGCGGG - Intronic
1017738214 6:157381921-157381943 TCGGGGGGCGGCCGGGCGGCCGG + Exonic
1017743732 6:157428617-157428639 GGCGGGGTGGGGCGGGCGGGGGG - Intronic
1017786008 6:157757812-157757834 TAGGGGCTAGGGCTGGCGTCGGG + Intronic
1018323412 6:162637263-162637285 TGGGGGGGGGGGCGGGTGGGAGG - Intronic
1018741558 6:166732966-166732988 TGGGGTGCAGGGTGGGAGGCAGG + Intronic
1018872940 6:167796848-167796870 TGTGGGCTGGGGCGGGCAGCAGG - Exonic
1018890506 6:167978247-167978269 CGGGGGTCAGCGCGGGCGGCCGG + Intergenic
1019179424 6:170177290-170177312 TGGGGGGAGGGGCAGTCGGCGGG + Intergenic
1019511247 7:1418726-1418748 TGGGGGGTGGGGGGGGGGGGTGG - Intergenic
1019689686 7:2403675-2403697 TGAGGGGCGCGGCGGGCGGCGGG + Intronic
1019828399 7:3301781-3301803 GGGGCGGTGCGGCGGGCGGCGGG + Exonic
1020007285 7:4789497-4789519 TGGGAGGTGGGGAGGCCGGCAGG + Intronic
1020106347 7:5423925-5423947 TGGGGGGGGGGGCGGGCACCCGG - Intronic
1020252784 7:6483473-6483495 CGGGAGGTGGGGCGGGCGCCGGG - Intronic
1020274458 7:6615903-6615925 CGGGGGCTGGGGCGGGAGGCAGG - Exonic
1020278292 7:6637471-6637493 TGGGCGGCGGCGCGGGCGGCAGG + Intronic
1020813551 7:12875372-12875394 TGGGAGGTGGGGCTGGGGGCAGG + Intergenic
1021055988 7:16046847-16046869 TGGGGGGCAGGATGGGTGGCAGG + Intergenic
1021092667 7:16501835-16501857 TGGGGGGTGGGGCGGGCCATGGG - Intronic
1021204842 7:17767682-17767704 TGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1021628077 7:22614486-22614508 TGAGGGGTAGGGTGGGCAGAGGG + Intronic
1021709169 7:23398055-23398077 TGTGGGGTGGGGCGGGGGGAGGG - Intronic
1022007374 7:26278247-26278269 TCGGGGGGAGGGGGGGAGGCGGG + Intergenic
1022207747 7:28180219-28180241 CGGGCGGGCGGGCGGGCGGCTGG - Intronic
1022375515 7:29807449-29807471 TGGCGGGGAGGGCGGGCACCCGG + Intronic
1022624031 7:32015521-32015543 TGGTGGGTGGGGTGGGGGGCAGG - Intronic
1022722979 7:32957416-32957438 CGGCCGGGAGGGCGGGCGGCCGG + Exonic
1022829993 7:34056235-34056257 TGGGGGGTAGGGTGGAGGGAGGG + Intronic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023159208 7:37281225-37281247 TGGGGGGAAGAGCGGGAGGGGGG + Intronic
1023579447 7:41665725-41665747 TGGGGGGTGGGGGGGGGGGAAGG + Intergenic
1024965456 7:55019418-55019440 TGCGCGGTTGGGCGGGCTGCGGG - Intronic
1025211286 7:57020662-57020684 AGGGAGGTAGGGCGGGGAGCTGG - Intergenic
1025660667 7:63556185-63556207 AGGGAGGTAGGGCGGGGAGCTGG + Intergenic
1026632958 7:72053784-72053806 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1026797868 7:73377555-73377577 GGGGCGGCCGGGCGGGCGGCGGG - Intergenic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1029098488 7:98107475-98107497 TTGGGGCTGGGGAGGGCGGCGGG + Intronic
1029146839 7:98452395-98452417 GGTGGGGTAGGGTGGGAGGCTGG + Intergenic
1029551670 7:101239962-101239984 TGAGGGGCAGGGCTGGCGGAAGG - Intronic
1030123433 7:106133046-106133068 GGGGGGGTTGGGGGGGTGGCGGG + Intergenic
1031491789 7:122398764-122398786 TGAGGGGTGGGGAGGGCGGCGGG - Intronic
1031692909 7:124812930-124812952 TGGGGGGTGGGGAGGGATGCAGG - Intergenic
1031901578 7:127417211-127417233 AAGGGGGTACGGCGGGGGGCGGG - Intronic
1031986371 7:128166996-128167018 TGTGGGGGACGGCGGGCGGCCGG + Intergenic
1032368995 7:131327783-131327805 GGGCGGGGAGCGCGGGCGGCCGG + Intronic
1032607360 7:133370129-133370151 TGGGGGGGAGGGTGGGCGGGGGG - Intronic
1032810170 7:135406294-135406316 TGGGGGGGAGGGTGGGGGGTGGG - Intronic
1032911692 7:136439635-136439657 TGGGGGGTAGAGTGGGGGGAGGG - Intergenic
1032962114 7:137047650-137047672 TGTGGGGTGGGGGGGGCGGAGGG + Intergenic
1033178366 7:139148812-139148834 TGGGGGGTTCGGGGGGCGGGTGG + Intronic
1033253088 7:139777492-139777514 TGGGGGCTGGGGCAGGCGCCGGG + Intronic
1033438530 7:141356639-141356661 TGCGGGGTTGGGCGGGGGGGTGG + Intronic
1033705568 7:143882636-143882658 GGGAGGGCAGGGCGGGAGGCCGG - Intronic
1034264011 7:149772836-149772858 GAGGGGGTCGGGCGGGAGGCAGG - Intronic
1034560582 7:151877156-151877178 TGGGCGAGAGGGAGGGCGGCGGG + Intergenic
1035277883 7:157758750-157758772 TGGGGGGTAGCGTGGGGAGCTGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036453974 8:8892602-8892624 GGGCGGGCAGGGCGGGCAGCTGG + Exonic
1036561367 8:9902869-9902891 TGGGGAGGAGGGCAGGCGGTAGG - Intergenic
1036723809 8:11201367-11201389 TGGGGGGGAGGGACGGCGGGGGG + Intergenic
1037737803 8:21581197-21581219 TGGAGGGTAGAGCAGGAGGCAGG - Intergenic
1037901876 8:22693320-22693342 TCGGGGGGCGGGGGGGCGGCGGG - Intergenic
1038045957 8:23765640-23765662 TGGGGGTGGGGGCGGGCGGGGGG + Intergenic
1038296052 8:26291721-26291743 GGGGGGGTAGAGAGGGCGGATGG - Intronic
1038447331 8:27612960-27612982 TGGGGGGCAGGGGGGGCGGGGGG + Intronic
1039277360 8:35947903-35947925 TGGGAGGTAGAGCTGGCGGCAGG + Intergenic
1039610081 8:38912827-38912849 TGGGGGGAAGGACTGGCTGCAGG - Intronic
1040292386 8:46132149-46132171 GGGTGGGGTGGGCGGGCGGCAGG - Intergenic
1040312112 8:46242116-46242138 GGGTGGGGTGGGCGGGCGGCAGG + Intergenic
1040884798 8:52249966-52249988 TAGGGGGTAGGGCTGGGGTCGGG - Intronic
1041428030 8:57745474-57745496 TGGGGGAAAGGGTGGGAGGCAGG - Intergenic
1041552771 8:59119521-59119543 GGCGGGGTAGGGAGCGCGGCCGG + Intergenic
1041923820 8:63215210-63215232 TGGGGGGTGGGGGGGGGGGGAGG - Intergenic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1043274932 8:78381223-78381245 TGGGGTGCAGGGAGGGCGGAGGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043398955 8:79864926-79864948 CGGGGGGCAGGGCGGGGGGGGGG + Intergenic
1044058736 8:87605725-87605747 TGGGGGGGAGGGCAGGGGGGAGG + Intronic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1044648956 8:94474781-94474803 TGGAGCGAAGGGCGGGCGGTGGG - Intronic
1044667077 8:94641779-94641801 TGGGGGGTGGGGCGGGGGGCAGG + Intronic
1044727935 8:95208181-95208203 TGTGGGGGAGGGGGGGGGGCGGG + Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045716021 8:105046677-105046699 GGGGGGGTGGGGCGGGGGGGCGG - Intronic
1045870764 8:106924352-106924374 TGGAGGGGAGGGCAGGGGGCAGG + Intergenic
1047339424 8:123966384-123966406 TGGGGGCCAGGGAGGGAGGCAGG - Intronic
1047654488 8:126961848-126961870 CGGGGGGTGGGGTGGGGGGCAGG + Intergenic
1047761927 8:127960936-127960958 TTGGGGGTGGGGGGGGCGGGCGG + Intergenic
1048375480 8:133818939-133818961 TGGGGTGGGGGGCGGGGGGCAGG + Intergenic
1048997471 8:139803323-139803345 TGGAGGGCAGGGCAGGCTGCAGG - Intronic
1049179128 8:141212132-141212154 TGGGCGGGCGGGCGGGCGGCGGG - Intronic
1049179132 8:141212140-141212162 TGGGCGGGTGGGCGGGCGGGCGG - Intronic
1049193482 8:141302388-141302410 TCGGGGGGAGGGAGGGCAGCGGG - Intronic
1049222424 8:141434138-141434160 TGGGGGGTGGGGTGGGTGGTGGG + Intergenic
1049756788 8:144314350-144314372 TGGGGGTGGGGGTGGGCGGCTGG - Exonic
1049789559 8:144466551-144466573 GTGGGGGTGGGGCAGGCGGCGGG - Intronic
1049790324 8:144469401-144469423 AGCGGGGCAGGGAGGGCGGCTGG + Intronic
1050231155 9:3526651-3526673 TGTGGAGGAGCGCGGGCGGCGGG + Intergenic
1050477224 9:6052914-6052936 GGGGGGGGGGGGCGGGGGGCAGG - Intergenic
1050552202 9:6758224-6758246 TGGGGGCCAGGGCGGGGGGAGGG + Intronic
1050569388 9:6921776-6921798 TGGGGGGTAGGGGTTGGGGCAGG - Intronic
1050624045 9:7484872-7484894 TGGAGGGTAGGGTGGGAGGAAGG + Intergenic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1050901343 9:10952499-10952521 TGGGGGGAAGGGGGCGGGGCGGG + Intergenic
1051079558 9:13279236-13279258 GTGGGGGTAGGGGTGGCGGCGGG - Intronic
1051567998 9:18522581-18522603 TGGGGTGTGGGGAGGGGGGCGGG - Intronic
1052494932 9:29213471-29213493 TGCGGGGCTGGGCGGGCGGCGGG + Intergenic
1052685164 9:31746156-31746178 TGGGTGGTAGGGAGGGGGGTAGG - Intergenic
1053142331 9:35689826-35689848 TGGGGGGTGGGCCGGCCGGCAGG + Exonic
1053142579 9:35690660-35690682 TGGGGGGCGGGGCGGGGAGCTGG - Exonic
1054202388 9:62097575-62097597 TGGGGGGCGGGGGGGGAGGCGGG + Intergenic
1054333484 9:63782280-63782302 TGGGGGATAGGGCTGAGGGCCGG - Intergenic
1055030621 9:71768897-71768919 TGGGCGGGCGGGCGGGCGGGCGG + Intronic
1055497366 9:76868830-76868852 TGGGGGGTGGGGGGGGGGGCGGG + Intronic
1055587088 9:77766638-77766660 GGGGGTGTAGGGTGGGAGGCTGG + Intronic
1056311456 9:85345845-85345867 TGGGGGGCAGGGCGGGGGTGGGG - Intergenic
1056532196 9:87497820-87497842 TTGGGCGGAGGGCGGCCGGCAGG - Intronic
1057295069 9:93830017-93830039 TGGGGGGCAGGGAGCGAGGCCGG - Intergenic
1057445026 9:95107712-95107734 TGGGGGTCAGGGCGGGGGGTCGG + Intronic
1057689548 9:97271438-97271460 TGGGGGGTGGGGAGGGGAGCCGG - Intergenic
1058619036 9:106863822-106863844 GGGGGCGGAGGGCGGGAGGCCGG + Intronic
1059734705 9:117089674-117089696 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1060722914 9:125990240-125990262 TGGAGGGTAGGCCAGGCGGTAGG - Intergenic
1060817561 9:126643151-126643173 TGGGGGCTAGGGGTGGAGGCTGG + Intronic
1061230276 9:129311934-129311956 TGGTGGGTGGGGCGGGGGGTCGG + Intergenic
1061540997 9:131277719-131277741 TGGGGCTTCGGGGGGGCGGCCGG + Intergenic
1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG + Exonic
1061651606 9:132054870-132054892 TGGAGGGTAGGGAGGAGGGCAGG - Intronic
1061768178 9:132896018-132896040 AGGGGGTTAGGGCGGGTGGAGGG + Exonic
1061895174 9:133643359-133643381 GGGAGGGGAGGGTGGGCGGCCGG + Intronic
1062034275 9:134375927-134375949 AGGGAGGGAGGGAGGGCGGCCGG - Intronic
1062241908 9:135545498-135545520 AGCGGGGTGGGGCAGGCGGCGGG + Intergenic
1062582019 9:137232957-137232979 GGGGGGGCAGGGTGGGCCGCAGG + Intronic
1062644855 9:137542662-137542684 TGTGGTGCAGGACGGGCGGCTGG - Exonic
1062656053 9:137605180-137605202 CGGGGGGCAGGGCTGGGGGCGGG - Intergenic
1203463899 Un_GL000220v1:68261-68283 TGGGGGGGAGGGAGGTGGGCGGG - Intergenic
1185893014 X:3836612-3836634 TGGGGGGGGGGGGGGGCGCCAGG + Intronic
1185903241 X:3913463-3913485 TGGGGGGGGGGGGGGGCGCCAGG + Intergenic
1186056367 X:5654045-5654067 GGGGGGGGGGGGCGGGGGGCGGG - Intergenic
1186099909 X:6144914-6144936 TGGGGGGTAGGGGTGGAGGGCGG + Intronic
1186802373 X:13106115-13106137 TGGGGGGCGGGGGGGGCGGGGGG - Intergenic
1186848151 X:13552229-13552251 TGAGGGGTAGGGGTGGGGGCAGG + Intergenic
1186901991 X:14066386-14066408 GGGGGGGGGGGGCGGGCGGCGGG - Intergenic
1187400841 X:18958643-18958665 TGGGAGGGAGGGCGGGCCACTGG + Intronic
1187580975 X:20606999-20607021 TGGGGGCTAGAGCAGGCAGCAGG - Intergenic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1188530900 X:31139700-31139722 TGGGGGGAAGGGTGGGAGGGGGG + Intronic
1189323138 X:40098040-40098062 AGGGAGGTAGGGCGGGCGGGAGG - Intronic
1189834455 X:45005963-45005985 TGGGGGGTGGGGGGGGTGGGGGG - Intronic
1190745886 X:53321435-53321457 TGGGGGCAGGGGCGGGGGGCGGG - Intergenic
1192855534 X:75006506-75006528 TGGGGAGTTGGGCGGGAGGCGGG - Intergenic
1193253039 X:79315638-79315660 TGGGGGGTAGAGTGGGAGGGGGG - Intergenic
1194129450 X:90062540-90062562 TGGGGGGAAGGGAGGGAGGGAGG + Intergenic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1195631417 X:107059334-107059356 TGTGGGGTGGGGTGGGCGGAAGG + Intergenic
1196973182 X:121131791-121131813 TGGGGGGTAGGGTTGGGGGAGGG - Intergenic
1197128784 X:122979567-122979589 TGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1197396647 X:125936028-125936050 TGTGGGGTGGGGCGGGGGGAGGG - Intergenic
1197604127 X:128564469-128564491 TGGGGGAAAGGGTGGGAGGCGGG + Intergenic
1198035560 X:132798046-132798068 AAGGAGGTAGGGCGGGGGGCGGG + Intronic
1198668597 X:139053000-139053022 TGGGGGGAAGGGTGGGAGGGGGG - Intronic
1198772372 X:140144706-140144728 TGGGGGGTGGGCGGGGGGGCGGG - Intergenic
1198791776 X:140354333-140354355 TGGGGGGTGGGGCGGGGGCGGGG - Intergenic
1198889972 X:141383010-141383032 TGGGGGGAAGGGTGGGGGGGGGG + Intergenic
1199252205 X:145676248-145676270 TGGGGGATAGGCCTGCCGGCTGG + Intergenic
1199296940 X:146170209-146170231 TGGGGGCTGGGGTGGGAGGCGGG - Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199471269 X:148198678-148198700 GGGGGCGGAGGGGGGGCGGCGGG + Intergenic
1199832971 X:151562849-151562871 TCGGGGGTCGGGGGGGCGGGGGG + Intergenic
1200100781 X:153688412-153688434 CGGGGCGGCGGGCGGGCGGCGGG - Exonic
1200105056 X:153707383-153707405 AGGGGGGGAGGGCGCGGGGCTGG + Intronic
1200138532 X:153886256-153886278 GGCGGGGCGGGGCGGGCGGCCGG - Intronic
1200214708 X:154362624-154362646 TGGGTGGGAGGGCAGGTGGCTGG - Intronic
1200216345 X:154369704-154369726 TGGATGGTAGGGGGGGCGACCGG - Intronic
1200418226 Y:2935347-2935369 CGGCTGGTAGGGCGGGCGGAGGG - Intronic