ID: 1061597738

View in Genome Browser
Species Human (GRCh38)
Location 9:131643073-131643095
Sequence GGCATCACGGGATAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061597733_1061597738 -8 Left 1061597733 9:131643058-131643080 CCTCAACTCTGAGATGGCATCAC 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1061597738 9:131643073-131643095 GGCATCACGGGATAGTTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1061597731_1061597738 15 Left 1061597731 9:131643035-131643057 CCGGGCTTCAGGAGTAATAGTGA 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1061597738 9:131643073-131643095 GGCATCACGGGATAGTTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 95
1061597730_1061597738 16 Left 1061597730 9:131643034-131643056 CCCGGGCTTCAGGAGTAATAGTG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1061597738 9:131643073-131643095 GGCATCACGGGATAGTTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061597738 Original CRISPR GGCATCACGGGATAGTTGTG GGG Intronic