ID: 1061599458

View in Genome Browser
Species Human (GRCh38)
Location 9:131657634-131657656
Sequence CAGCCACAGCAGCCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061599458_1061599463 23 Left 1061599458 9:131657634-131657656 CCTGATTGTGGCTGCTGTGGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1061599463 9:131657680-131657702 GTGTAAACAGCCCCTGGGGCTGG No data
1061599458_1061599460 17 Left 1061599458 9:131657634-131657656 CCTGATTGTGGCTGCTGTGGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1061599460 9:131657674-131657696 TTAACTGTGTAAACAGCCCCTGG No data
1061599458_1061599464 30 Left 1061599458 9:131657634-131657656 CCTGATTGTGGCTGCTGTGGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1061599464 9:131657687-131657709 CAGCCCCTGGGGCTGGTGACTGG No data
1061599458_1061599461 18 Left 1061599458 9:131657634-131657656 CCTGATTGTGGCTGCTGTGGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1061599461 9:131657675-131657697 TAACTGTGTAAACAGCCCCTGGG No data
1061599458_1061599462 19 Left 1061599458 9:131657634-131657656 CCTGATTGTGGCTGCTGTGGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1061599462 9:131657676-131657698 AACTGTGTAAACAGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061599458 Original CRISPR CAGCCACAGCAGCCACAATC AGG (reversed) Intronic
902435013 1:16392915-16392937 CAGCCACATCAACCACTATTTGG - Intronic
902849132 1:19139852-19139874 CAGCCACAGCATCCAGGATCAGG + Intronic
902883036 1:19385457-19385479 CAGGCACAGCAGGCACACGCGGG - Intronic
903065992 1:20699835-20699857 CCTCCACAGCTGTCACAATCTGG - Intronic
903327903 1:22581886-22581908 CAGCCAAAGAAGCCACCAACGGG - Intronic
904283318 1:29436713-29436735 CAGCCAGAGCAGCCAGGATATGG - Intergenic
904450880 1:30610706-30610728 CAGCCACAGCAGCCAGGACAGGG + Intergenic
904573791 1:31488589-31488611 CAACACCAGCAGCAACAATCAGG + Intergenic
904834354 1:33325201-33325223 CACCCACAGCAGCCGCGATCTGG + Intronic
904840090 1:33367137-33367159 CAGCCACAGCAGGAACCGTCCGG + Exonic
905990757 1:42335192-42335214 CAGCAAGAGCAGCCAACATCCGG + Intronic
907242751 1:53089907-53089929 CAGCCACTGCAGCCAGCATTGGG - Exonic
907300216 1:53482272-53482294 CGGCCTCAGCAGCCAGAACCCGG + Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
912557401 1:110526060-110526082 TAGCCACAACAGACACACTCAGG + Intergenic
912690533 1:111801474-111801496 GAGCCACAGAAGGCAGAATCAGG - Intronic
917934033 1:179846787-179846809 TTGCCACAACAGCCACAACCAGG + Exonic
919188816 1:194189305-194189327 CAACACCAGCAGCAACAATCAGG - Intergenic
919323824 1:196080245-196080267 TAGCCTCAGCAGCCAGAAGCTGG - Intergenic
920650470 1:207833614-207833636 CAGCACCAGCATCCACAGTCAGG + Intergenic
921302111 1:213761346-213761368 TGGCCACAGCAGCCAATATCTGG + Intergenic
922508885 1:226146057-226146079 CACCCAAAGCAGAAACAATCTGG + Exonic
1062792547 10:318161-318183 CAGCCACCGCTGCCACACTTTGG + Intronic
1062831695 10:610045-610067 CGTCCACAGCAGCCAAGATCCGG + Intronic
1062862433 10:821399-821421 CAGCCTCAGGAACCACATTCTGG + Intronic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1065275912 10:24085527-24085549 CAGACACAGTACCCACAATGGGG - Intronic
1068091936 10:52442467-52442489 CAGCCACATCAGCCACGGACTGG - Intergenic
1069776145 10:70928453-70928475 CAAACACAGCAGCCACAATCAGG - Intergenic
1071686881 10:87767541-87767563 CAGCCCCTGCAGCCACAGACTGG - Intronic
1072244700 10:93532812-93532834 TAGCCACGACAGCCACAATGTGG - Intergenic
1073124216 10:101139898-101139920 CAAACACAGCAGCCCCAAGCTGG + Intergenic
1073346746 10:102788775-102788797 CTGCAAGAGCAGCCACAACCTGG + Intronic
1073763747 10:106659097-106659119 CAGCCATAGCATCAGCAATCAGG + Intronic
1074277424 10:112017112-112017134 CAGCAACAGCAGCCCCACCCAGG + Intergenic
1077521277 11:3036591-3036613 CAGCCACTGCAGAAACAATACGG + Intronic
1079006326 11:16793805-16793827 CAGCCACAGAGGCCACAGACCGG + Intronic
1080656531 11:34262964-34262986 CAGCCACAGGAGACGAAATCAGG + Intronic
1080975270 11:37332139-37332161 AAGCCACAGAAACCACATTCAGG - Intergenic
1081676652 11:44973974-44973996 CAGCCCCAGCAGCCAGGAGCAGG + Intergenic
1081741693 11:45445390-45445412 CAGGCACAGCAGCAGCAACCAGG - Intergenic
1083156891 11:60828839-60828861 CGGCCACAGCAGCCACTCCCAGG + Intergenic
1083235635 11:61349138-61349160 AAGCCACAGCAGCAACACTTAGG + Exonic
1083797562 11:65026224-65026246 CAACACCAGCAGCAACAATCAGG + Intronic
1084423504 11:69072052-69072074 CAGCCACAGCACCCACCCTCAGG - Intronic
1084520710 11:69661036-69661058 CAGCCCCTGCAGGCACTATCCGG - Intronic
1085051852 11:73384034-73384056 CAGGCTCAGGAGCCACTATCTGG + Intronic
1089410449 11:118237210-118237232 CAACCACAGCAGGCACATTTCGG - Exonic
1090349332 11:126097523-126097545 CGGCCACATCAGCCACTGTCAGG + Intergenic
1093264874 12:16991008-16991030 CAACACCAGCAGCAACAATCAGG - Intergenic
1095301466 12:40589535-40589557 GAGTCACAGCAGCCACAGCCAGG - Intergenic
1096030695 12:48411459-48411481 GAGCCACAGCAGCTTCAAACTGG - Intergenic
1096740508 12:53690464-53690486 CAGCCTCAGCTGCCTAAATCTGG + Intergenic
1097058926 12:56267833-56267855 CAGCCTCAGCCGCCAAGATCTGG - Exonic
1099373278 12:81865199-81865221 AAGGCACAGAAGTCACAATCTGG - Intergenic
1101691472 12:107086570-107086592 CAGCCAGAGCAGCCAGAACGTGG - Intronic
1102676813 12:114665021-114665043 CAGGCACAGAACCCACAGTCGGG - Intergenic
1102727163 12:115075780-115075802 CAGTCACAGCAGCCAGAATAAGG - Intergenic
1104937003 12:132370712-132370734 CATTCACAGCAGCCACGATATGG - Intergenic
1106181666 13:27374545-27374567 CAGCCTCTGCAGCGACAACCAGG + Intergenic
1111075536 13:83230296-83230318 CAGCTACAGCAGACACCATTGGG - Intergenic
1113482378 13:110630887-110630909 CAGCCACAGCAGTCAAGACCGGG - Intronic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1114141991 14:19922716-19922738 TAGTCACAACAGCCACAATAAGG + Intergenic
1114230923 14:20781912-20781934 CACAGACAGCAGCCACATTCTGG - Exonic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1117622687 14:57603664-57603686 GAGCCACAGCTGTAACAATCTGG - Intronic
1117677370 14:58168390-58168412 CATTCAAGGCAGCCACAATCTGG - Intronic
1119029816 14:71183236-71183258 CAGGCACAGAAGCCACCATCAGG + Intergenic
1119910756 14:78347172-78347194 CTGCTACAGAAGCTACAATCAGG - Intronic
1122562542 14:102626669-102626691 CTGCCACAGCAGGCACAGTGAGG + Intronic
1122785607 14:104162045-104162067 CAGACACAGCAGCCCCCATCTGG - Intronic
1122820948 14:104344538-104344560 CTGCCTCTGCAGCCAGAATCGGG - Intergenic
1122878474 14:104679431-104679453 CAGCCGCAGCAGCCACTCTGTGG + Intergenic
1123553839 15:21407018-21407040 CTGCCACAGCTGCCACACTTTGG - Intergenic
1123662211 15:22574386-22574408 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124262007 15:28201121-28201143 CAGCCACAGCAGCCTCTGTCTGG + Intronic
1124316013 15:28668668-28668690 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1125195970 15:37046196-37046218 GAGCTGCAGCAGCCACAGTCTGG - Intronic
1125218954 15:37311159-37311181 CAGCCACTGGAGCCATAAGCTGG + Intergenic
1125679510 15:41522184-41522206 CAGCCCCAGGAGCCACACACTGG + Exonic
1126010371 15:44296925-44296947 CTGCCTCACCAGCCATAATCTGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1128081599 15:64860478-64860500 TGGCAACAGTAGCCACAATCTGG + Intronic
1129189534 15:73929281-73929303 CAGGCACAGCAACCTCAATGGGG - Intronic
1130441053 15:83954978-83955000 GACCCACTGCAGCCACTATCTGG + Intronic
1132936046 16:2481794-2481816 CAGGCTCAGCAGCCACAGTTAGG + Intronic
1132943241 16:2518859-2518881 CAGCCTCAGCAGCCCCCATGTGG - Intronic
1133832639 16:9338306-9338328 CTGCTGGAGCAGCCACAATCTGG - Intergenic
1135127665 16:19824484-19824506 CAGCCCCTGCAGCCACATGCTGG - Intronic
1135979316 16:27134819-27134841 CAACACCAGCAGCAACAATCAGG + Intergenic
1136126476 16:28186153-28186175 CATCCACAGCAAACACCATCAGG + Intronic
1137024495 16:35459285-35459307 CAGCCACAACAGCCACCGTTTGG - Intergenic
1137231263 16:46569651-46569673 CAGCCACAGCCGCTGCAGTCCGG + Intergenic
1139472878 16:67187589-67187611 CACGCACAGCAGCCACCAACAGG + Exonic
1142030343 16:87835378-87835400 CTGGCACAGCAGGCACAAGCTGG + Intronic
1142169420 16:88613280-88613302 CAACCACAACAGCCAAAAGCTGG - Intronic
1142904716 17:3034133-3034155 ACCCCACAGCAGCCATAATCAGG - Exonic
1143626005 17:8110421-8110443 GAGCCACAGCAGGCACAGTGGGG + Exonic
1143919406 17:10318937-10318959 AAGCCACAGCAGCCACCCTGAGG - Exonic
1143994599 17:10995825-10995847 CACCCACAGCAGCCACAGCTGGG + Intergenic
1144834392 17:18149303-18149325 TGGGTACAGCAGCCACAATCAGG + Exonic
1145235490 17:21205177-21205199 CTGTCCCAGCAGCCACAGTCTGG + Intronic
1145260283 17:21350660-21350682 CAGCCTCAACAGCCTCAACCCGG - Intergenic
1145316336 17:21737280-21737302 CAGCCTCAACAGCCTCAACCCGG + Intergenic
1147589053 17:41669533-41669555 CAGCCACACCAGCCCCCAGCTGG - Intergenic
1148667442 17:49385155-49385177 GAGCCATTGCAGCCACACTCTGG + Intronic
1150469526 17:65424998-65425020 CAGCCACAGCAGAAAGATTCAGG + Intergenic
1151669501 17:75564287-75564309 CAGCCTCAACAGCCACAGGCCGG - Intronic
1151986052 17:77544538-77544560 CAGCCAGAGCAGCCCCACGCGGG + Intergenic
1152549193 17:81020946-81020968 CAGTAACAGCAGCCACACCCAGG + Intergenic
1154058445 18:11034700-11034722 CAGCCACAGCACCCAGCCTCTGG - Intronic
1156060271 18:33065803-33065825 CAGCAACAAGAGCAACAATCTGG + Intronic
1156228362 18:35130777-35130799 CAGGCGCAGCAGCTACACTCAGG - Intronic
1158253534 18:55517817-55517839 CACACACAGCAGCTCCAATCAGG + Intronic
1158345990 18:56517726-56517748 CAGGCACATCAGCCACAACCTGG - Intergenic
1159025938 18:63182274-63182296 CAGCCACAGCCTGCACAATCAGG + Intronic
1160381276 18:78457963-78457985 AAGCCACAGCAGCCTCTAGCTGG + Intergenic
1160445505 18:78924477-78924499 CAGTCACAGCTGCCACGCTCAGG + Intergenic
1160889532 19:1369891-1369913 CAGCCACAGCAGGGACACGCTGG - Intronic
1160910956 19:1473609-1473631 CAGCCACAGCAGCCACTACCGGG + Exonic
1160929943 19:1565955-1565977 CAGCCACAGCCTCCACCACCTGG + Intronic
1161334338 19:3704353-3704375 CAGCCACATCAGCCTCACCCTGG + Intergenic
1161479571 19:4503786-4503808 GAGCCACAGCAGCCACAGCTGGG - Exonic
1161967923 19:7558946-7558968 CTTCCACAGCAGCCACCAGCCGG - Exonic
1162668699 19:12237238-12237260 CAGCAACTGCAGCCTCAGTCCGG - Intronic
1164489334 19:28692317-28692339 GAGCCAGAGCAGCCAGAATGTGG - Intergenic
1165780279 19:38429179-38429201 TAGTCACAGCAGCCCCAACCTGG - Intergenic
1166383590 19:42368581-42368603 CAGGCACACCAGCCGCAATGGGG - Exonic
1167091797 19:47349380-47349402 CAGCCATCGCCGCCACAACCCGG - Intronic
925860787 2:8173252-8173274 CAGCCCCAGCAGCCAGGCTCCGG - Intergenic
925989772 2:9245284-9245306 CAGCCACGGCAGCAACACACTGG - Intronic
927395829 2:22650194-22650216 CAAACACAGCAACCACAACCAGG + Intergenic
927642306 2:24852858-24852880 CAGCCCCACCAGCCACACTCTGG - Intronic
928330520 2:30354682-30354704 CAGCCACAGCAGGCAGAACTGGG + Intergenic
928916985 2:36482865-36482887 CAGTAACAACAGCCACAATAAGG - Intronic
930740924 2:54831852-54831874 CATCCACAGCATCCACACTGTGG - Intronic
930909258 2:56611030-56611052 CAGCCACTGGAGCCATAACCTGG - Intergenic
932336908 2:70936895-70936917 CAGGCACAGGAGCCACAAGTAGG - Intronic
933770503 2:85741230-85741252 CAGCCACTGCAGACTCCATCAGG + Intergenic
934307668 2:91840362-91840384 AAGCCGCAGCAGCAAAAATCCGG - Intergenic
934654496 2:96110156-96110178 CACCCACAGCAACCAGGATCTGG + Intergenic
934705802 2:96479230-96479252 CACCCACAGCAGCCAAAAGATGG - Intergenic
934707627 2:96495651-96495673 CAGAAACAGCAGCAACAAACTGG - Intergenic
934784469 2:96995091-96995113 CAGCCATCCCAGCCACACTCCGG - Intronic
935801223 2:106698316-106698338 CAACACCAGCAGCAACAATCAGG + Intergenic
936006364 2:108892446-108892468 CATTCCCAGCAGCAACAATCTGG + Intergenic
936039516 2:109139477-109139499 CAGCCACAGAAGGCACAAGGGGG - Intronic
936892855 2:117392586-117392608 GAGCCACAGCAGCCACTTCCAGG - Intergenic
937436850 2:121888081-121888103 CAGTCACAGCAGCCAGAGGCTGG - Intergenic
940014972 2:149094782-149094804 CATACAAAGCAGCCACAATATGG - Intronic
940451594 2:153844386-153844408 GAGCCAGAGCAGCCAGAATGTGG + Intergenic
942136944 2:172935307-172935329 CCTCCCCAGCAGCCACAATGAGG + Intronic
943511537 2:188833153-188833175 AAGCCACAGGAGCCATAAGCTGG + Intergenic
944581785 2:201138105-201138127 CATCCACACCAGCGTCAATCAGG + Intronic
946095402 2:217270238-217270260 CAGTAACAGCAGCCACAACCTGG + Intergenic
948694560 2:239726690-239726712 CAGCCTCATCAGCCAAACTCAGG - Intergenic
1168861140 20:1046760-1046782 CAGCCTCAGCATCAACAATGGGG + Intergenic
1169136210 20:3199382-3199404 CAGCCACAGCACCCACATCCAGG + Intronic
1169181532 20:3573215-3573237 GAGCAACTGCAGCCAGAATCTGG - Intronic
1169416733 20:5423693-5423715 GAGCTGCAGCAGCCACAACCAGG - Intergenic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1172827720 20:37804636-37804658 CAGCCACAGCATCCACCCTGAGG - Intronic
1173588554 20:44205304-44205326 GATACACTGCAGCCACAATCTGG + Intronic
1173656007 20:44700783-44700805 CAGCCACTGTGGCCACAATGGGG + Intergenic
1173991133 20:47304531-47304553 CAGCCAGAGCACCCATACTCTGG - Intronic
1175526436 20:59637762-59637784 CAGCCACATCAACCACAATAGGG - Intronic
1178716331 21:34967910-34967932 CAGCCACAGCACCTACATTAAGG - Intronic
1179336568 21:40462200-40462222 CAGCCATACCACCCACAAACAGG + Intronic
1179517615 21:41919701-41919723 CCGCCACAGCAGCCTCTAACTGG + Intronic
1179708320 21:43195111-43195133 AAGGCACAGCAGCCACGAGCTGG - Intergenic
1179930807 21:44569790-44569812 CACACACAGCAGCCTCCATCGGG - Intronic
1180987352 22:19912739-19912761 CAGCCACAGCAGCCTCTAGAGGG - Intronic
1183079872 22:35449524-35449546 GGGACACAGCGGCCACAATCAGG - Intergenic
1183190357 22:36318530-36318552 CAGACTCAGCAGCCACATACAGG + Intronic
1183441340 22:37824785-37824807 CAGCCACACCAGCCCCACTGCGG - Exonic
1183922125 22:41177715-41177737 CAGCCCCAGCAACTACAGTCTGG + Exonic
1184659628 22:45959926-45959948 GAGCCACAGGAGCCAGAAGCGGG + Intronic
1185226970 22:49658653-49658675 CAGACACAGAAGCTCCAATCAGG - Intergenic
950856467 3:16110187-16110209 CTGCCACAGAACCCACAACCTGG + Intergenic
952741154 3:36736331-36736353 CACTCACAGCAGCCACAAAGGGG + Intronic
952931692 3:38365670-38365692 CACCCACAGCAGCCTCCAGCTGG - Exonic
953052546 3:39358882-39358904 CAACACCAGCAGCAACAATCAGG - Intergenic
953843553 3:46408892-46408914 CTGCAAGAGCAGCTACAATCTGG + Exonic
954299412 3:49691488-49691510 CACCCCCAGCAGCCACCAGCAGG + Exonic
955260017 3:57378951-57378973 CACCCACACCAGCCCCAACCAGG + Intronic
959619829 3:108387954-108387976 CAGCCTCAGGAACCAGAATCAGG + Intronic
961357953 3:126350878-126350900 CAGCCACAGCAGCAAAGATTTGG + Intronic
962443305 3:135443139-135443161 CAGCCACAGCAGGAAGCATCTGG + Intergenic
964044732 3:152309245-152309267 CAGGGACAGCTGCCACAGTCTGG - Intronic
966833058 3:184027395-184027417 CAACACCAGCAGCAACAATCAGG + Intergenic
966871283 3:184291858-184291880 CAGCCACAGCAGGCAGCTTCTGG + Intronic
967452360 3:189640394-189640416 CAGCCACATCAGCCTCTATAGGG - Intronic
967735261 3:192945124-192945146 CAGCCATTGCTGCCACAACCAGG + Intergenic
969058469 4:4416517-4416539 CAGCCACAGCTGCCAAAACAGGG + Intronic
969121553 4:4915008-4915030 CAAACACAGCAGCCCTAATCAGG - Intergenic
969539675 4:7779396-7779418 CAGGCACAGCAGCAACACTATGG + Intronic
969833985 4:9823977-9823999 AAACCACAGCAGCCACATTAAGG - Intronic
970322880 4:14892823-14892845 CAGGCACAGCAGCCAACAGCCGG + Intergenic
973328808 4:48891421-48891443 CAGCCATGGCAGCCCCACTCTGG - Intronic
973705376 4:53575617-53575639 CAGCCAATGCAGCCAAAAGCGGG - Intronic
973822450 4:54674407-54674429 CAGCTACAGGAACCACTATCAGG - Intronic
974077886 4:57184398-57184420 CAGCCAGAGCTACCACATTCAGG + Intergenic
976713417 4:88098184-88098206 CAGCCACAAGAACAACAATCAGG + Intronic
979592890 4:122500909-122500931 CAGGCACAGCAAGCACATTCAGG + Intergenic
981026806 4:140084984-140085006 TAGCAACAGCAGCCACAACAAGG - Intronic
981813527 4:148802761-148802783 CAAACACAGGAGCCACAATGTGG - Intergenic
982361505 4:154524028-154524050 CAGCCACTCCAGCCTCCATCTGG - Intergenic
985699638 5:1362808-1362830 CAGCAACAAGAGCCAAAATCAGG + Intergenic
986128810 5:4908580-4908602 CAGCCACAGAAGCCACTATGAGG + Intergenic
986284852 5:6351626-6351648 CAGGCACAGGAGACACAAGCAGG + Intergenic
987107343 5:14652966-14652988 CAACACCAGCAGCAACAATCGGG + Intergenic
987216787 5:15745889-15745911 CTTCCACAGCAGCCACATTTGGG - Intronic
988992336 5:36683869-36683891 CAGCCACAGCTGCCAGTATTGGG + Exonic
990521873 5:56588769-56588791 CAGCCCCAGCAGCTACATCCTGG - Intronic
992551566 5:77865189-77865211 GAGCCACAGCAACCACACACAGG - Intronic
993129276 5:83875231-83875253 CAACAACTGCAGCCAGAATCGGG + Intergenic
995480398 5:112586791-112586813 CAAACACAGCAGCCTCAGTCAGG + Intergenic
996315268 5:122153913-122153935 AAGACAAAGCAACCACAATCTGG - Intronic
998087314 5:139336977-139336999 CAGCAGAAGCAGCCAAAATCAGG - Intergenic
998261164 5:140632948-140632970 CAGCAGCAGCAGCAACAAGCAGG + Exonic
998654798 5:144165524-144165546 CAGCCACAACAGCCATACACCGG - Exonic
999444308 5:151627096-151627118 CAGCTACAGCAGCTACACACAGG - Intergenic
1000980804 5:167814848-167814870 CAGCTCCAGCAGCTCCAATCAGG + Intronic
1003019554 6:2497667-2497689 CAGCCCCACCAGCCACAAGGTGG - Intergenic
1004304335 6:14487052-14487074 CAGCCACCCAAGCCACAACCCGG + Intergenic
1004807035 6:19213933-19213955 AAGCCACTGCAGCCATAAACTGG - Intergenic
1008280701 6:49592339-49592361 CTTCCACACCACCCACAATCAGG - Intergenic
1008775402 6:55031993-55032015 CCCCCACAGCAGCCACAGTAAGG - Intergenic
1008927647 6:56903924-56903946 CAGACTCTGCAGCCACTATCTGG + Intronic
1010229041 6:73519192-73519214 CAACACCAGCAGCAACAATCAGG + Exonic
1011562620 6:88637053-88637075 CAGTCCCAGCAGCCACCATCTGG - Intronic
1011801111 6:91017378-91017400 AAACCACAGCAGCCACTTTCTGG + Intergenic
1014149151 6:118033722-118033744 CAGCCACAGCAGCAAGAAGAGGG + Intronic
1015768563 6:136745460-136745482 CTGCCACAGCAGCCAGAGGCAGG - Intronic
1017358568 6:153539852-153539874 AAGCCACTGTAGCCACAAACTGG + Intergenic
1018125256 6:160676560-160676582 CAGCTGCAGCACCCACAACCAGG + Intergenic
1018392443 6:163350726-163350748 GAGGCAGAGCAGCCACAATGAGG + Intergenic
1018662612 6:166102170-166102192 CAGCCAGAGCAGCCAGGATGTGG + Intergenic
1020915802 7:14191135-14191157 CAGCACCAGCAGCAACAATCAGG - Intronic
1021321866 7:19222471-19222493 CAGACACCGAAGCCATAATCTGG - Intergenic
1021616968 7:22511639-22511661 CAACACCAGCAGCAACAATCAGG + Intronic
1022113662 7:27245762-27245784 CAGCCAAAGCAGACACCAGCCGG - Intronic
1024431239 7:49290177-49290199 CTGCCACAGCTCCCACCATCAGG - Intergenic
1028259097 7:88639351-88639373 CAGCACCAGCAGCAACAATCAGG - Intergenic
1028389578 7:90299602-90299624 CAGCCACATCAGTCACATTTTGG + Intronic
1032078257 7:128846270-128846292 CAGCCACAGGGGCATCAATCAGG - Intronic
1032135682 7:129274844-129274866 CAGCCCTAGCAGACACCATCTGG + Intronic
1032665338 7:134030556-134030578 CAGCCACAGCAGCCCCCATAAGG + Intronic
1033485072 7:141780622-141780644 CAGCCACAGAAACAACATTCTGG - Exonic
1033779090 7:144648214-144648236 CAACACCAGCAGCAACAATCAGG + Intronic
1034808708 7:154110997-154111019 CAGACACAGCAGATACATTCAGG - Intronic
1035288002 7:157818591-157818613 CAGCCACAGGAGGCACCAGCTGG - Intronic
1035492615 7:159293562-159293584 AATCCACAGCATCCACCATCAGG + Intergenic
1036103235 8:5810835-5810857 GAGACACAGCAGGCACACTCTGG + Intergenic
1038344424 8:26718975-26718997 CTGACACAGCAGCAACATTCAGG + Intergenic
1040359508 8:46651815-46651837 CAGCCACAGCCCTCACAAGCTGG - Intergenic
1040701149 8:50067706-50067728 CAGCCAAGGCAACCAAAATCAGG - Intronic
1040745231 8:50634089-50634111 CAGCCTCAGCACCCACCATGCGG + Intronic
1041074589 8:54157917-54157939 CAACCACAGCAGCCAAAAGATGG - Intergenic
1042090160 8:65150848-65150870 CAGCCACAAAAGACAGAATCTGG - Intergenic
1046201116 8:110928933-110928955 CAGCCACAGCACTGACAAGCTGG - Intergenic
1047701862 8:127456866-127456888 CAGCCAGAGCAGCCTCTAACTGG + Intergenic
1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG + Intronic
1049284170 8:141765681-141765703 CAGCCACAGCCCCCACATGCTGG + Intergenic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1049685459 8:143937556-143937578 CAGCCACAGCAGCCACCGGTGGG + Intronic
1050331316 9:4549282-4549304 CAGCCACAGCAGACACCAGGAGG - Intronic
1052627365 9:30993769-30993791 TAGCAACAGCAGCCACAATTTGG + Intergenic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1055627803 9:78192551-78192573 CAGATACAGCAACCACAATAGGG + Intergenic
1056706141 9:88954033-88954055 CAGCCACAACAGCTGCAACCTGG + Intergenic
1056838435 9:89977214-89977236 CAGCTACAGTAGCCACATTCTGG - Intergenic
1058135826 9:101306516-101306538 CAGCCACAGCAATCACAACAAGG + Intronic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1061784670 9:133019824-133019846 CAACACCAGCAGCAACAATCAGG - Intergenic
1062673664 9:137726543-137726565 CAACCACAGCAGCCAAAAGGGGG - Intronic
1062675145 9:137738610-137738632 CAACCACAGCAGCCAAAAGGGGG + Intronic
1187522398 X:20025331-20025353 GTGCCACAGCAGCCACCATCTGG + Intronic
1188129417 X:26413069-26413091 CAGCCACAGTAGCCAGCTTCTGG + Intergenic
1189013889 X:37076321-37076343 CAGACACTGGAGCCACAGTCTGG + Intergenic
1189361954 X:40359770-40359792 CATCCACACCAGCGTCAATCAGG + Intergenic
1189396975 X:40631817-40631839 CATCCCCAGCAGCCATGATCTGG - Intronic
1189656657 X:43251529-43251551 CGGCCACAGCAGCCAGGATGTGG + Intergenic
1193182952 X:78480328-78480350 CAGCCACTGTAGAAACAATCTGG + Intergenic
1193820750 X:86161293-86161315 CAACACCAGCAGCAACAATCAGG + Intronic
1195504762 X:105644442-105644464 AAGCCACAGCAACCTCATTCAGG + Intronic
1195962121 X:110397071-110397093 CTCCCAGAGCAGCCACAGTCTGG + Intronic
1199462426 X:148099405-148099427 CAGCAACAGCAGCCTAAAACAGG + Intergenic
1199696876 X:150348848-150348870 CAGCCAGAGCAGGCAGAATGGGG - Intergenic
1201571962 Y:15424277-15424299 CAGCCACAGCAGGCTCTAACAGG + Intergenic