ID: 1061608197

View in Genome Browser
Species Human (GRCh38)
Location 9:131727544-131727566
Sequence CCTGGACCTGTGGCATCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061608197 Original CRISPR CCTGGACCTGTGGCATCTTT GGG (reversed) Intronic
900495479 1:2974144-2974166 CCTGGACCTGTGCCTTCTCCAGG + Intergenic
901237213 1:7673510-7673532 CCTGGTCCTGGGGCATTTCTGGG + Intronic
901458141 1:9375699-9375721 CCTGGTCCTGTGGCTTCTTCTGG - Intergenic
902682884 1:18056150-18056172 CCTTGACCCCTGGCATCTGTGGG - Intergenic
902705379 1:18200678-18200700 CCTGTAACTGTGGCCTCATTTGG - Intronic
904423644 1:30409823-30409845 CCTGGACCTCAGGCCTCTCTCGG + Intergenic
905125517 1:35713613-35713635 CCTTGTCCTGTGTCACCTTTGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906529160 1:46513264-46513286 CCTGCACCTGCGGCCTCTCTAGG + Exonic
909323323 1:74317776-74317798 CCTGGACCTGTGTCAGCCCTGGG + Intronic
911883615 1:103270773-103270795 CCTGCACCAGTGGCCTCATTGGG + Intergenic
912556987 1:110523706-110523728 CCTAGAACTTTGTCATCTTTGGG + Intergenic
912680509 1:111726141-111726163 CCTGGACATGTAGCATATCTAGG + Exonic
914329121 1:146649674-146649696 CCTGAACTGGTGGCATGTTTTGG - Intergenic
914732364 1:150382943-150382965 CCTGTAATTCTGGCATCTTTGGG - Intronic
915603738 1:156938206-156938228 CCTGGACAGGTGGCTTCTTAAGG + Intronic
915703833 1:157824369-157824391 CCTGCACCTGTGGCTTCATGGGG - Intergenic
920238913 1:204529434-204529456 CCTGGAGCTGTACCATCATTTGG + Intronic
922007849 1:221550559-221550581 CCTGACCCTGGGGCATCTTGTGG - Intergenic
922194364 1:223346842-223346864 CCTGGACCAAGGGCATGTTTTGG - Intronic
922306013 1:224345334-224345356 CCTGGACCTCTGATTTCTTTTGG + Intergenic
923687064 1:236160748-236160770 CCAGGCCCTGTGGCAGCTTAAGG + Intronic
924474703 1:244372790-244372812 CCTGGACATGTGGGGTCTTTCGG - Intronic
924477353 1:244393885-244393907 CCTGAACCTGTGGCTTCATGGGG - Intergenic
1062856365 10:781364-781386 CCTGGGCCTGGGGCCTCTGTGGG + Intergenic
1063002348 10:1936227-1936249 CCTGCACCTGTGGCCTCATGGGG + Intergenic
1064714757 10:18165391-18165413 ACTGCACCTGTGCCCTCTTTTGG + Intronic
1065131102 10:22621169-22621191 TCTGGACCTGGGGGATCTTGAGG + Intronic
1065901409 10:30211327-30211349 CCTGTACCTGCGGCATGATTGGG + Intergenic
1068132815 10:52915997-52916019 CCTTGAGCTATGGCATCTCTGGG - Intergenic
1069881713 10:71597478-71597500 CCTGTACCTGTGGCAGCTTCAGG - Intronic
1070529994 10:77328370-77328392 ACTGGTCCTGTGGCCTCGTTGGG - Intronic
1070895039 10:79976316-79976338 CCTGGATCTCAGGCTTCTTTGGG - Intronic
1070992851 10:80747651-80747673 CCTGGTGCTGTGGCATGTCTTGG - Intergenic
1072522194 10:96238528-96238550 CCTGAACCTGGGGAGTCTTTAGG - Intronic
1072786528 10:98286867-98286889 CTTGGACCTGAGGCAGCTCTGGG - Intergenic
1074737684 10:116453064-116453086 CCTGCCCCTGTGGCTTCTCTGGG - Intronic
1074776422 10:116771150-116771172 CGTGGACTTGGGGCATCTCTGGG - Intergenic
1074793918 10:116921501-116921523 CATGGACATGAGGGATCTTTGGG + Exonic
1075857947 10:125646856-125646878 CCTGGACCTGGGGCTGTTTTCGG - Intronic
1076226634 10:128781825-128781847 CCTGGTCATGTGACCTCTTTTGG + Intergenic
1076303012 10:129442032-129442054 CCTGAAGCTGTGGGATCCTTGGG - Intergenic
1077893419 11:6436426-6436448 CCTTGACCCGTGGCATCAATTGG - Intronic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1081772773 11:45659925-45659947 CCTGGCCCAGGGGCATCCTTGGG - Intronic
1081827503 11:46071136-46071158 CTTGGCCATGTGGCTTCTTTTGG + Intronic
1081920129 11:46767594-46767616 CCTGGAGCTTTGGCCTTTTTTGG + Exonic
1084111969 11:67020109-67020131 CCTTGACCTCTGGGACCTTTGGG - Intronic
1085695991 11:78705177-78705199 TCTGGTCCTGTGGCACCTTGGGG + Intronic
1087647863 11:100828887-100828909 CCTGGGCATGTGGCAACTGTTGG - Intronic
1090346419 11:126075255-126075277 TCTGGAACTCTGGCATCTTGGGG + Intergenic
1092442000 12:8512682-8512704 GAAGGACCTGTGGCATCTGTGGG - Intronic
1097264069 12:57736053-57736075 CCCGGGCCTGTGGCTTCTCTCGG - Intronic
1102322077 12:111944766-111944788 CCTGGCCCTGTGTGAGCTTTAGG - Intronic
1103817698 12:123671677-123671699 CCTGGAGAGGTGGCATCCTTGGG + Intronic
1106404686 13:29463368-29463390 CTTGGACCTGTGACCTCTCTAGG - Intronic
1110018273 13:70436617-70436639 TCTAGACCTGTGGAATTTTTGGG - Intergenic
1111452745 13:88440150-88440172 ACTAGACCTGTGGGATCTGTGGG + Intergenic
1115359017 14:32480805-32480827 CCTGGACCAGTAGGATCTTCAGG - Intronic
1115364604 14:32543788-32543810 CCAGGGCCGGTGTCATCTTTTGG + Intronic
1115371718 14:32623099-32623121 ACTGAACCTGTGGCATCTATAGG - Intronic
1115819506 14:37198612-37198634 CCTGGACCTGGTGCAACGTTTGG + Intronic
1116308003 14:43283162-43283184 CCTGTTCCTATGGCCTCTTTGGG - Intergenic
1117344539 14:54819402-54819424 TCTGGATTTGTGGCATCTTTTGG - Intergenic
1118208054 14:63741690-63741712 CCAGAACCTGTGGCATCTCTAGG - Intergenic
1119033713 14:71212500-71212522 CCTGGACATTTGGCTTGTTTAGG - Intergenic
1121512190 14:94520798-94520820 CCTGCACGTGTGGCAGCTTGGGG - Intergenic
1122457248 14:101863934-101863956 CCTAGACCTGTGGACTCTCTGGG + Intronic
1124145314 15:27119783-27119805 CTTGGAACTGTGGCACCTCTGGG - Intronic
1127416537 15:58763133-58763155 CCTGTACCTGTGCAATCTTCTGG + Intergenic
1128034778 15:64515297-64515319 CATGGACTGGTGGCATCTCTTGG + Intronic
1128091860 15:64924521-64924543 ACTGGGCCTGTGGCATCTATAGG - Intronic
1129565457 15:76617761-76617783 TCTGGACCTGTGACTTGTTTTGG - Intronic
1130345189 15:83037785-83037807 CCTGGCCTGGTGGAATCTTTAGG - Intronic
1130578260 15:85112666-85112688 CCTGGTCCTGTAACGTCTTTGGG + Intronic
1132804032 16:1767484-1767506 CCTGGAGCTGTGGCAGGTTTGGG + Intronic
1140004443 16:71061259-71061281 CCTGAACTGGTGGCATGTTTTGG + Intronic
1141059139 16:80848905-80848927 CTTGGACCAGTGGCTTCTTAGGG + Intergenic
1141110920 16:81270092-81270114 CCTGGCACTGTGGCATCTGGGGG - Intronic
1141439858 16:84023093-84023115 CCTGGTACTGTGGCGTGTTTGGG - Intronic
1142110826 16:88330216-88330238 ACGGGACCTGTGGCATCCTGTGG + Intergenic
1144308830 17:13993806-13993828 CCTGGACCAGCAGCATCTCTTGG - Intergenic
1146614940 17:34348916-34348938 TCTGGACCTGTGGCTTCTTGGGG + Intergenic
1146718052 17:35102914-35102936 CCTGGGCCTGGGGGACCTTTTGG + Intronic
1148846980 17:50535091-50535113 CCTGGACCTGTGGCTACTGGGGG + Intronic
1152457041 17:80422546-80422568 CCGGGCCCTGGGACATCTTTTGG - Intronic
1156310471 18:35917809-35917831 CCAGGACCTGTGGCTTCTCAAGG + Intergenic
1160922875 19:1528909-1528931 CCTGGACCCGAGGCCTCTTTAGG - Exonic
1163188493 19:15658391-15658413 CCTGAGGCTGTGGCACCTTTGGG - Exonic
1164588134 19:29490400-29490422 CCTGGTCCTGTAGCCTCCTTGGG + Intergenic
1168132469 19:54330343-54330365 CCTGAGCCTGTTGCAACTTTAGG - Intergenic
927096944 2:19754556-19754578 CATGTAGCTGTGGCCTCTTTGGG - Intergenic
929979975 2:46669163-46669185 CCAGGGCCTGTGGCTTCTTTTGG - Intergenic
930576550 2:53157536-53157558 CTTGGATCTGTGACATGTTTAGG - Intergenic
931768707 2:65479299-65479321 CCTGGACATGTGGCCTATATGGG - Intergenic
932893529 2:75616447-75616469 TCTGGACCTGTGTCCTCATTGGG - Intergenic
933751508 2:85604902-85604924 CCGGGACATGAGGCAGCTTTTGG + Intronic
934730926 2:96656998-96657020 CCTGGATCTGTTGCTTCATTGGG + Intergenic
935828276 2:106973288-106973310 CTAGGTCCTGTGGCTTCTTTAGG + Intergenic
936777266 2:115988858-115988880 CCTGGCACTATGGAATCTTTGGG - Intergenic
937565998 2:123289861-123289883 CCTTGACCTGTGGAAACTGTAGG + Intergenic
938701041 2:133880012-133880034 CCTGCAGTTGTGGCAGCTTTGGG - Intergenic
939755312 2:146102441-146102463 CCTGCACCTGTGGCCTCATGGGG + Intergenic
940392021 2:153143125-153143147 CCTGGACAGCTGGCATTTTTAGG + Intergenic
944206272 2:197161893-197161915 CCTGGATCTGTTCCATCTTGAGG - Intronic
945556414 2:211281734-211281756 GCTGGCCCTGTGGCTACTTTTGG - Intergenic
946777967 2:223163741-223163763 CCTGGAACAGTGGGGTCTTTAGG - Intronic
947847889 2:233260278-233260300 CCTGGACTAGTGACATCTTCTGG + Intronic
1169402372 20:5294039-5294061 TCTGGACATGTGAAATCTTTTGG + Intergenic
1174443268 20:50573198-50573220 CAGGGACCTGTGGCATCATCTGG - Intronic
1174668652 20:52284743-52284765 TCTGGACCTGGGGGATGTTTAGG + Intergenic
1175167091 20:57052022-57052044 CCTGGACTTGAGGCAGCTTGAGG + Intergenic
1175551274 20:59819592-59819614 GCTGGACCTGTGGGATCTGCAGG - Intronic
1175872345 20:62214436-62214458 CCTGGAGCGAAGGCATCTTTGGG - Intergenic
1179712121 21:43269324-43269346 CCTGGGCCTCTGGGGTCTTTGGG + Intergenic
1182346752 22:29671739-29671761 ACTGGAGATGGGGCATCTTTGGG + Intronic
1184473257 22:44707589-44707611 TCTGGGTCTGGGGCATCTTTTGG - Intronic
949905917 3:8858343-8858365 CCTGCACCTGTGGCTTCATGGGG + Intronic
950428441 3:12937301-12937323 CCTGGCCCTGGTGCATCTTGAGG + Intronic
952036930 3:29214041-29214063 CATGGACATGTGGAATCATTTGG + Intergenic
952916731 3:38251852-38251874 CATGGACCTGTGGCCTCACTGGG - Intronic
954037642 3:47860662-47860684 CCTGGACCTGTGGGTTCAGTAGG - Intronic
955784189 3:62519002-62519024 CATGGTTCTGTGTCATCTTTAGG + Intronic
957752967 3:84446878-84446900 CATTCACCTGTGGCATCTTAGGG + Intergenic
957874624 3:86129584-86129606 CCTGCACCTATGGCCTCTTGGGG + Intergenic
961501901 3:127342306-127342328 CCTTGAGGTGTGGCATCTATTGG - Intergenic
967388424 3:188931833-188931855 TCTGGAGCTATGGCATATTTTGG + Intergenic
969118994 4:4893207-4893229 CCTGGACCTGTGACTACATTAGG + Intergenic
969853073 4:9977422-9977444 CCAGGACCTGTGGCTGCTTGAGG - Intronic
970161223 4:13191233-13191255 CTTGGTCATGTGGCATATTTTGG - Intergenic
970804756 4:20017822-20017844 CATGGACCTGAGCCAACTTTAGG + Intergenic
970894672 4:21088245-21088267 CCTGGAACTGAGGCGTCTTGTGG + Intronic
976385590 4:84454061-84454083 CATGGCCCTGTGGCATCCCTGGG - Intergenic
977706441 4:100076093-100076115 TCTGGAACTGAGGCTTCTTTTGG + Intergenic
977718406 4:100209727-100209749 CCTCAACCTGTGGCATCTGATGG + Intergenic
979888527 4:126061887-126061909 CCTGTACCTCTGGCCTCTTGGGG - Intergenic
981240174 4:142467288-142467310 CCTGCCCCTGTGGCTTCTGTGGG - Intronic
985947087 5:3194210-3194232 CCTGGTCCTGTGGCAGCGCTGGG + Intergenic
986285637 5:6356319-6356341 CCTGGACCTTTGGATTCGTTAGG - Intergenic
988962478 5:36383867-36383889 CCTGGTGCTGTGGCATTTTGAGG - Intergenic
994991457 5:107001761-107001783 TCTTGCCCTGTGGCATATTTTGG - Intergenic
995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG + Intronic
997317435 5:132949340-132949362 CCTGGCTCTCTGCCATCTTTTGG + Intronic
1003419227 6:5940626-5940648 GCTGGACCACTGGCACCTTTAGG - Intergenic
1003940038 6:11015551-11015573 CCTGGACCTGTCCCTTCTATTGG + Intronic
1004183070 6:13397473-13397495 CCAGGCCCTCTGGCATCTCTGGG + Intronic
1007686930 6:43672484-43672506 CATGGACCTTTGGCCTCCTTTGG + Exonic
1008236452 6:49057522-49057544 CCTGGTCCTGTGGCTTTTTAGGG + Intergenic
1009378375 6:62999493-62999515 CCTGGTACTGTGGCATGTCTGGG + Intergenic
1011513407 6:88126278-88126300 ACTGGACCTGTGGCAGCTCTGGG - Intergenic
1014018859 6:116565486-116565508 CCTGGCCCTGCGGCTGCTTTCGG + Intergenic
1016816301 6:148306254-148306276 CCTGGTTCTCTGGCTTCTTTTGG - Intronic
1017051848 6:150400680-150400702 CCTGGGCCTGTATCATCATTGGG + Exonic
1019105216 6:169661633-169661655 CATGGACCTGAGGCATTTTGAGG - Intronic
1019142568 6:169957506-169957528 CCTGGGCAGGTGGCACCTTTGGG + Intergenic
1019514357 7:1433213-1433235 CCTGGCCCTGAGGCCTCTCTTGG - Intronic
1020084598 7:5303615-5303637 CCCTGACCTGTGGCATCGTGTGG - Exonic
1020142507 7:5620449-5620471 CCTGGACCAGTGACAGCATTGGG - Intronic
1022826741 7:34022322-34022344 CCTCGTCCTGTGCCAGCTTTGGG + Intronic
1029420853 7:100471188-100471210 CCCGGATCTGTGGTGTCTTTGGG + Intronic
1034594895 7:152180772-152180794 CCTGGACCTGTGCCAACTTCAGG - Exonic
1035116731 7:156531195-156531217 CCTGGATATATGCCATCTTTGGG - Intergenic
1037887683 8:22603496-22603518 CCTGGAGCTGCGGCATCTTGGGG - Exonic
1037890800 8:22622871-22622893 CTTGGTCCTGTGCCATCTTTAGG - Intronic
1038454420 8:27663352-27663374 CCTGCACCTGTGGCCTCATGGGG - Intronic
1038980086 8:32750424-32750446 CCTGGCCCTGTGGAGTCTCTGGG - Intronic
1039014385 8:33129663-33129685 CCTGGTACTGTGGCATGTCTGGG + Intergenic
1039117174 8:34104307-34104329 CCTGGGACTGTGCCATATTTTGG + Intergenic
1043253259 8:78102300-78102322 CCTGGACATGGGGCAGATTTGGG - Intergenic
1044627396 8:94247398-94247420 CCTGGAGCCTTGGCATCTGTTGG + Intergenic
1046494223 8:114993338-114993360 CTTTGCCCTGTGGCATGTTTGGG + Intergenic
1047633734 8:126736297-126736319 CATGCACATGTGGCATCTTGAGG - Intergenic
1047948948 8:129911964-129911986 CTTAAACCTGTGGAATCTTTAGG - Intronic
1050423260 9:5488873-5488895 CCTGGGCCCCTGGCAGCTTTAGG + Intergenic
1050481098 9:6087471-6087493 CCTGGTACTGTGGCATGTCTGGG - Intergenic
1050599825 9:7239114-7239136 CCTGAAGTTGTGGCATCATTGGG + Intergenic
1051891244 9:21944991-21945013 ACTGCAACTGTGGCCTCTTTTGG - Intronic
1053276562 9:36787771-36787793 CCTGGATCTGTGGTCTCTCTAGG + Intergenic
1056934613 9:90906484-90906506 GCTGGACATGTGACATCTGTTGG - Intergenic
1058533958 9:105935508-105935530 TCTGGACCTGTAGCCTCTTCGGG - Intergenic
1059398362 9:114053177-114053199 GCTGGACCTGTGAGATCTTTGGG - Exonic
1059490633 9:114663676-114663698 TCTGGACCTGTTGCCTGTTTGGG - Intergenic
1061214303 9:129212080-129212102 CCTGGACCTGTGAGTTCTTGAGG + Intergenic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1061608197 9:131727544-131727566 CCTGGACCTGTGGCATCTTTGGG - Intronic
1062089936 9:134670552-134670574 CCTGGGCCTGTGGCACGTCTTGG + Intronic
1062345951 9:136115385-136115407 CCTGCCCCTGTGCCATCATTTGG + Exonic
1187115749 X:16348624-16348646 TCTGGACCTTTGGCATTTTCAGG - Intergenic
1187236319 X:17470648-17470670 AAAGGACCTGTGGCATATTTAGG - Intronic
1187938900 X:24362646-24362668 TGTGGACTTGTGGCATCTTGCGG + Intergenic
1193162163 X:78240492-78240514 ACTGCACCTGTGGCCTCTGTTGG - Intergenic
1194479903 X:94408417-94408439 CCTAGATCTCTGGCATCTTCAGG + Intergenic
1194853398 X:98897873-98897895 CCTTGAACTTTGACATCTTTGGG - Intergenic
1196435968 X:115675038-115675060 CCTGGAACTGTGGATTCTGTTGG + Intergenic
1196747638 X:119085842-119085864 CCTGAGCCTCTGGCATCCTTGGG - Intronic
1201643807 Y:16205453-16205475 CCTGGTACTGTGGCATGTCTGGG - Intergenic
1201659008 Y:16379868-16379890 CCTGGTACTGTGGCATGTCTGGG + Intergenic