ID: 1061609164

View in Genome Browser
Species Human (GRCh38)
Location 9:131734936-131734958
Sequence GTGAACTGCTCCAAGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061609160_1061609164 -6 Left 1061609160 9:131734919-131734941 CCACTTTAGCAGGCCCAGTGAAC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1061609164 9:131734936-131734958 GTGAACTGCTCCAAGGTGACAGG No data
1061609159_1061609164 1 Left 1061609159 9:131734912-131734934 CCTGTGGCCACTTTAGCAGGCCC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1061609164 9:131734936-131734958 GTGAACTGCTCCAAGGTGACAGG No data
1061609155_1061609164 28 Left 1061609155 9:131734885-131734907 CCATCTTCAGGCAGCGTGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 171
Right 1061609164 9:131734936-131734958 GTGAACTGCTCCAAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061609164 Original CRISPR GTGAACTGCTCCAAGGTGAC AGG Intronic
No off target data available for this crispr