ID: 1061609299

View in Genome Browser
Species Human (GRCh38)
Location 9:131735703-131735725
Sequence GTCGGAGGTGTGGCTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061609290_1061609299 22 Left 1061609290 9:131735658-131735680 CCGAGGAGGGGATGCAAACGCAA No data
Right 1061609299 9:131735703-131735725 GTCGGAGGTGTGGCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061609299 Original CRISPR GTCGGAGGTGTGGCTGGCTG TGG Intronic