ID: 1061609776

View in Genome Browser
Species Human (GRCh38)
Location 9:131739062-131739084
Sequence CTCGACAGTCATTGAATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061609767_1061609776 20 Left 1061609767 9:131739019-131739041 CCTGCAAGGTGCTGCAGGCTAAT 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1061609776 9:131739062-131739084 CTCGACAGTCATTGAATCTTTGG No data
1061609766_1061609776 21 Left 1061609766 9:131739018-131739040 CCCTGCAAGGTGCTGCAGGCTAA 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1061609776 9:131739062-131739084 CTCGACAGTCATTGAATCTTTGG No data
1061609772_1061609776 -7 Left 1061609772 9:131739046-131739068 CCTGGGGCCCCACAGGCTCGACA 0: 1
1: 0
2: 1
3: 18
4: 157
Right 1061609776 9:131739062-131739084 CTCGACAGTCATTGAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061609776 Original CRISPR CTCGACAGTCATTGAATCTT TGG Intronic
No off target data available for this crispr