ID: 1061609881

View in Genome Browser
Species Human (GRCh38)
Location 9:131739549-131739571
Sequence GCTGCGGGGGCGCCAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 871}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061609881_1061609900 15 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609900 9:131739587-131739609 CGCCCGGCAGGCAATGGGCCTGG No data
1061609881_1061609897 10 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609897 9:131739582-131739604 CCCCGCGCCCGGCAGGCAATGGG No data
1061609881_1061609895 9 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609895 9:131739581-131739603 CCCCCGCGCCCGGCAGGCAATGG No data
1061609881_1061609890 -1 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609890 9:131739571-131739593 CGGCCGCTTCCCCCCGCGCCCGG No data
1061609881_1061609892 3 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609892 9:131739575-131739597 CGCTTCCCCCCGCGCCCGGCAGG No data
1061609881_1061609903 18 Left 1061609881 9:131739549-131739571 CCGGCCCCTGGCGCCCCCGCAGC 0: 1
1: 0
2: 2
3: 74
4: 871
Right 1061609903 9:131739590-131739612 CCGGCAGGCAATGGGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061609881 Original CRISPR GCTGCGGGGGCGCCAGGGGC CGG (reversed) Intronic
900000975 1:14737-14759 GCTGCGGTGGCGGCAGAGGAGGG + Intergenic
900013316 1:133662-133684 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900020690 1:185258-185280 GCTGCGGTGGCGGCAGAGGAGGG + Intergenic
900064818 1:724646-724668 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900182145 1:1315793-1315815 GCAGCGAGGGAGGCAGGGGCAGG + Intronic
900227607 1:1540380-1540402 GCCGGGGGGGCGCCGGGGCCGGG - Intronic
900243394 1:1627186-1627208 GCTGCGGAGGCGCCCAGAGCAGG + Exonic
900243804 1:1628754-1628776 GCTGCGGTGGCGCCGGCAGCAGG + Intronic
900307731 1:2019314-2019336 GCGGCGCGGGCGCGAGGGGGCGG - Intergenic
900342987 1:2197436-2197458 GCTGCGGGTGCCCCAAGGGTAGG + Intronic
900364776 1:2306642-2306664 GCTGCGGGAGCGCGAGGCCCGGG + Exonic
900393519 1:2443894-2443916 GCAGCGAGGGCGGCGGGGGCGGG - Intronic
900399762 1:2468082-2468104 GGTCTGGGGGTGCCAGGGGCTGG + Intronic
900581821 1:3413260-3413282 GCCGCTGTGGCTCCAGGGGCAGG - Intronic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
901012373 1:6209093-6209115 GCTGCGGGGGCGGCGGGCGGTGG - Exonic
901086276 1:6613993-6614015 GGAGCGGGGCCGCCCGGGGCTGG - Exonic
901373069 1:8817251-8817273 GCTGCGGGGCCGCGGGGCGCAGG + Exonic
901433886 1:9234729-9234751 GCGGCGGGGGCGCGCGCGGCGGG - Intergenic
901456767 1:9367631-9367653 GGTGCGGCGGCCCCAGCGGCAGG - Exonic
901607690 1:10472277-10472299 GGTGTGGGGGAGCCAGGGCCGGG - Intronic
901673037 1:10867096-10867118 GCTGCGGGGGCGGCGGGGGTTGG - Intergenic
902400021 1:16152507-16152529 GCAGCGGGGTGGGCAGGGGCAGG + Intronic
902467249 1:16625963-16625985 GCTGCAGGGCCGGCAGCGGCAGG - Intergenic
902509524 1:16958633-16958655 GCTGCAGGGCCGCCTGGCGCTGG + Exonic
902749403 1:18496751-18496773 GCTACGGGGGAGCCTGAGGCAGG + Intergenic
903044087 1:20552950-20552972 GCGGCGGCGGCGAAAGGGGCTGG - Exonic
903132729 1:21290227-21290249 GCGGCGGCGGCGCCAGGGTCGGG - Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
903269349 1:22178004-22178026 GGTGCGGGGGAGCCATGGGCAGG - Intergenic
903446083 1:23423928-23423950 GGTGCGGGGGCCCGCGGGGCGGG - Intronic
903468450 1:23568408-23568430 GCCGCGGCGGGGCCAGGCGCCGG + Intergenic
903828629 1:26161902-26161924 GCTCCGGGGACGCCAGCGACTGG + Exonic
903975799 1:27149231-27149253 GCTGCGGGAATGCCAGAGGCAGG + Intronic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
904625254 1:31798675-31798697 GCTGGGTGGGCGGCAGGGTCTGG + Intronic
904724982 1:32539954-32539976 GCCGCGGGGGCGCGCGGGGAGGG + Intronic
904787294 1:32992555-32992577 GCTGAGGGCGTGTCAGGGGCTGG - Intergenic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
906078411 1:43068401-43068423 GCGGCGGGGGCGGCGGGGGCGGG + Intergenic
906140489 1:43531229-43531251 GCTGCGGGCGCGGCAGGTGGGGG - Intronic
906383407 1:45347122-45347144 GGTGCAGGGGAGGCAGGGGCAGG - Intronic
906640814 1:47439334-47439356 GCGGCGGGGGCGCCGGGGCAGGG + Exonic
906676076 1:47694465-47694487 ACTGTGGGGGCTGCAGGGGCTGG + Intergenic
906720013 1:47997466-47997488 GGGGCGGGGGGGCGAGGGGCCGG + Intergenic
906919515 1:50048499-50048521 GCTGCGGGGTCGCCTGTCGCTGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907501961 1:54887390-54887412 GAGGCGGGGGTGCCAGGGACTGG + Intergenic
907525458 1:55051336-55051358 GCTGCAGGGGTTCCAGGGCCAGG + Intronic
907880652 1:58546578-58546600 CCTGCGGGGGCGCCCGGGCAAGG - Intronic
908131939 1:61082849-61082871 GGGGCCGGGGCGCCGGGGGCAGG + Intronic
908272941 1:62437618-62437640 GCGGCGAGGGCGCCCGGCGCGGG + Intronic
908951405 1:69567474-69567496 GCTGCCCGAGCGCCCGGGGCTGG + Intergenic
909475277 1:76074816-76074838 GCAGCGGGCGCGCCTGGGTCAGG - Exonic
909585252 1:77282010-77282032 GCAGCGCGGCCGCCAGGGGTGGG - Intergenic
910678973 1:89843476-89843498 GCGGCGGGGTCGCCACGGCCAGG + Intronic
911664757 1:100539761-100539783 GCAGCGCGGGCGGCAGGGGCTGG - Exonic
912381448 1:109250005-109250027 GCGGCGGGGCCGGCAGGAGCCGG + Exonic
912993498 1:114511145-114511167 GCTGCGGCTGCGGCTGGGGCTGG - Exonic
913676617 1:121146887-121146909 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
913974100 1:143440396-143440418 GCTGGGTGAGTGCCAGGGGCAGG - Intergenic
914028513 1:143934837-143934859 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
914068489 1:144266010-144266032 GCTGGGTGAGTGCCAGGGGCAGG - Intergenic
914110666 1:144700344-144700366 GCTGGGTGAGTGCCAGGGGCAGG + Intergenic
914213956 1:145607887-145607909 GCCGCGGAGGCCCCAGGGGCGGG - Intergenic
914465901 1:147928290-147928312 GCCGCGGAAGCCCCAGGGGCGGG - Intergenic
914803167 1:150974772-150974794 GCGGCGGCGGCGCCGGCGGCTGG - Exonic
914889863 1:151612633-151612655 GCTGCGGAGGCCTGAGGGGCGGG - Intronic
915224994 1:154405547-154405569 GCGGCAGGGGTGGCAGGGGCGGG - Exonic
915246298 1:154558484-154558506 GCAGCTGGGGGGCCAGGGGGCGG - Exonic
915325269 1:155078768-155078790 GTCGGGGGCGCGCCAGGGGCGGG + Intergenic
915343518 1:155188731-155188753 GGTGCGGTGGAGCCCGGGGCCGG + Intronic
915535117 1:156530780-156530802 GCAGGTGGGGGGCCAGGGGCAGG - Intronic
915936555 1:160093169-160093191 CCTGCGGGGGCACCTGGGCCCGG - Exonic
916056121 1:161069787-161069809 GTGGCCGGGGCCCCAGGGGCAGG - Exonic
916720341 1:167480442-167480464 GCTCTGGGGGTGTCAGGGGCAGG - Intronic
917755388 1:178093765-178093787 GCGGCGGCGGCGGCAGCGGCAGG - Intergenic
917905855 1:179586657-179586679 GGGGCGGGGGCGGCGGGGGCAGG + Intergenic
919792749 1:201302749-201302771 GCTGTGGGGGCGGGAGGGGAGGG - Intronic
919841756 1:201614382-201614404 GCTGCGGGCGCCTCAAGGGCAGG + Intergenic
919896505 1:202012688-202012710 GCTGCCGGGGTGGTAGGGGCTGG - Exonic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
920463979 1:206165728-206165750 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
920522165 1:206635737-206635759 GATGCGGGGCCGCCTGGGGCCGG + Exonic
920912678 1:210233034-210233056 GCCGCGGGGGCGGGAGGGCCGGG + Intronic
921866653 1:220094095-220094117 GCTCCGGGAGCGGAAGGGGCGGG - Exonic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922034628 1:221836196-221836218 GCTGTGGGGGAGTCAGAGGCTGG - Intergenic
922099723 1:222470665-222470687 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922261757 1:223950160-223950182 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922315082 1:224434686-224434708 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
922351400 1:224737211-224737233 GCTGCGGGGGTGGGAGGGGGTGG + Intronic
922462486 1:225824139-225824161 ACTGCGGGGGCGGCGGGGGTGGG - Intronic
922735323 1:227975585-227975607 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
922753743 1:228082879-228082901 GCGGCGGCGGCGACAGGGCCGGG + Intronic
923684154 1:236142424-236142446 GGGGCGGGGGCGCGCGGGGCCGG + Intergenic
924342922 1:243052332-243052354 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
924436869 1:244049435-244049457 GCTGCAGTGGCGCCCGGGGGAGG + Intronic
924624729 1:245688751-245688773 GCTCCGTGGGCGGCAGGTGCCGG + Exonic
924732522 1:246724636-246724658 GCTGCGCGGGCGGCTGGGCCGGG + Intronic
1063623445 10:7667917-7667939 GTTGCGGGGGCGCGTGGGGTAGG - Intergenic
1063662715 10:8045099-8045121 GCTGTGCAGGCGCCAGGGGCCGG + Intergenic
1064230782 10:13528443-13528465 GCCGCCGGGGCGGCGGGGGCAGG - Intronic
1064392465 10:14953855-14953877 GCTCCCGGGGCGCTGGGGGCTGG - Intronic
1065099666 10:22321039-22321061 GCTGGGGGGGCGGCGGGGGGAGG + Intronic
1065660279 10:27998920-27998942 GCGGCGGCGGCGCCCGGGGGAGG - Intronic
1065921911 10:30400164-30400186 GCTGTGTGGGAGCCAGGGACTGG - Intergenic
1066733561 10:38453220-38453242 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1067793599 10:49305208-49305230 GCTGCAAGGTAGCCAGGGGCAGG + Intronic
1067842442 10:49691749-49691771 CCTGCAGGAGGGCCAGGGGCAGG + Intronic
1071086887 10:81875422-81875444 GCTGCGGCGGCGGCAGCGGCGGG + Exonic
1071631601 10:87223025-87223047 CCTGCGGCGGCGCACGGGGCAGG + Intergenic
1072021860 10:91410406-91410428 GCGGCGGGAGCGCCAGGCGGCGG - Exonic
1072562267 10:96587021-96587043 GCTGAGGAGGCGCGGGGGGCGGG - Exonic
1075031990 10:119029894-119029916 GCTGCGGGTGCGCCGGGCCCGGG - Exonic
1075344939 10:121675036-121675058 GCTGCAAGGGAGCCAGGGACAGG + Intergenic
1075575364 10:123573513-123573535 TGTGCTGGGGCGCCCGGGGCTGG + Intergenic
1075724991 10:124606516-124606538 GCTGCAGGGTCCCCAGGTGCAGG + Intronic
1075729841 10:124629556-124629578 GCTGCAGGGGCCCCAGGCTCTGG + Intronic
1076116963 10:127907444-127907466 GCCGCGGGGGCGGCGGGGCCGGG - Intronic
1076384021 10:130044480-130044502 GCTGCCAGGGAGCCAGGGGCTGG + Intergenic
1076480953 10:130785027-130785049 GCAGTGGGGGCGCCGGGAGCAGG - Intergenic
1076707092 10:132307983-132308005 GCTGGGGGCGGGGCAGGGGCGGG + Intronic
1076723947 10:132404806-132404828 GCAGCGGCGGCACGAGGGGCGGG - Exonic
1076839864 10:133040633-133040655 GCTGTGGGCGGGGCAGGGGCGGG + Intergenic
1076868593 10:133181622-133181644 CCTGCGGGGGAGGCAGGGCCAGG + Intronic
1076871669 10:133197781-133197803 GCTGGTGGGGCAGCAGGGGCTGG - Intronic
1076876191 10:133216999-133217021 GCAGGGTGGGCGCCGGGGGCTGG + Intronic
1076879043 10:133231062-133231084 GCTGGCGGGGAGCCGGGGGCGGG - Exonic
1076969652 11:125866-125888 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1076985975 11:236363-236385 GGGGCCGGGGCGCCGGGGGCGGG - Exonic
1076985995 11:236402-236424 GGGGCTGGGGCGCCGGGGGCGGG - Exonic
1077016279 11:400370-400392 GATGCGGGAGTGCCACGGGCTGG + Exonic
1077052644 11:574734-574756 GCGGCGCTGGGGCCAGGGGCTGG - Intergenic
1077066061 11:641345-641367 GCGGCAGCGGGGCCAGGGGCTGG + Intergenic
1077121459 11:910841-910863 GGCGCGCGGGCGCCTGGGGCGGG - Intronic
1077159145 11:1104748-1104770 GCTGCGGGGGCACCAGTGCGTGG - Intergenic
1077169593 11:1160281-1160303 GCAGCGTGGGGGCCAGGGCCTGG + Intronic
1077308549 11:1878470-1878492 GATTCGGGGGCGCGGGGGGCGGG + Intronic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1077489260 11:2852966-2852988 GCTGTGGGGGCTGCAGGGGAGGG - Intergenic
1077532682 11:3104570-3104592 GCTGCGGGTGCTCCAGGGGTGGG - Intronic
1077886276 11:6390363-6390385 GCTGCGGAGGCGGAGGGGGCGGG - Intergenic
1078233322 11:9461521-9461543 GCAGCGGGGGCGCCGGGGACAGG + Intronic
1079407738 11:20160386-20160408 ACTGTGGGGGCGGGAGGGGCGGG - Exonic
1080012356 11:27472085-27472107 GCGGCGGGGACGCGAGGGGGGGG - Intronic
1080622923 11:34002217-34002239 GCTGTGGGGGAGGCTGGGGCAGG + Intergenic
1081774050 11:45665702-45665724 GCTGGGGCGGCGCGGGGGGCGGG - Intergenic
1081867417 11:46367315-46367337 GCGGAGGGGGGGCCAGGTGCTGG - Exonic
1082076936 11:47981458-47981480 GCGGCGGGGGCGACAGGGCAGGG + Intronic
1083270083 11:61567796-61567818 GGTGAGGGGGCGGCGGGGGCCGG - Intronic
1083300813 11:61738839-61738861 GCTGAGGGCTCGCCCGGGGCAGG - Intronic
1083593684 11:63909248-63909270 GGAGCGGGGGCGGCGGGGGCGGG + Exonic
1083594993 11:63914954-63914976 ACTGCAGGGGCAGCAGGGGCAGG + Exonic
1083750812 11:64759631-64759653 GCTGCTGGGGAGCCTGGGGTGGG - Intronic
1083753688 11:64778047-64778069 GCTGCGGCGGCGACACGCGCTGG + Exonic
1083844138 11:65321294-65321316 GCTGAGGGGTCTCCAGGTGCAGG - Exonic
1083889727 11:65589775-65589797 GCTGTGGGTGGGCCTGGGGCAGG - Exonic
1083920583 11:65779958-65779980 GCTGCGGGGCCTGCTGGGGCAGG - Exonic
1084004809 11:66317097-66317119 CCTGCGGGCGGGCCGGGGGCGGG + Intergenic
1084046025 11:66568237-66568259 GGGGCGGGGGCGCCAGGCCCGGG - Intronic
1084214817 11:67641527-67641549 GATACGGGGGCACCAGGGACAGG - Intergenic
1084429935 11:69105506-69105528 GCTGTGGGGGCACCCCGGGCCGG - Intergenic
1084468529 11:69341595-69341617 GCTGCTGTGGGTCCAGGGGCTGG - Intronic
1084720463 11:70902429-70902451 GGTGGGGAGGCGGCAGGGGCTGG - Intronic
1084837490 11:71813558-71813580 GCTGAGGTGGCGCGGGGGGCGGG - Intergenic
1084959742 11:72710168-72710190 GGTGCGGGGGAGCAAGGGCCAGG + Intronic
1085011081 11:73142158-73142180 GGGGCGGGGGCCCCAGGAGCAGG + Exonic
1085266687 11:75241622-75241644 GCTCCAGGCGCGCCAGGCGCAGG - Exonic
1086697625 11:89863934-89863956 GCTGCAGGCGCTGCAGGGGCAGG + Intergenic
1086708534 11:89980554-89980576 GCTGCAGGCGCTGCAGGGGCAGG - Intergenic
1088223229 11:107591225-107591247 GCTGCGGGCGCGGAAGGGGCGGG - Exonic
1088870453 11:113886197-113886219 GTTGCGGGGGGGGCAGGGGGTGG - Intergenic
1089078852 11:115760095-115760117 GCGGCGGGGGCGCTGGGCGCGGG - Intergenic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1089216567 11:116837797-116837819 GCTGCGGGGGCTGCAGGGCAGGG + Exonic
1089381713 11:118037447-118037469 GCTGAGGGGGCCCCAGGGTCCGG + Intergenic
1090635796 11:128689855-128689877 GCGGCGGGAGGGCCGGGGGCGGG - Intronic
1090835319 11:130449491-130449513 GCTGCGGGGTGGCCTCGGGCTGG + Exonic
1091184672 11:133636849-133636871 GGTGCGGGGCGGCCAGGGACAGG + Intergenic
1091374064 12:14852-14874 GCTGCGGTGGCGGCAGAGGAGGG + Intergenic
1091787603 12:3252458-3252480 GCTGGGGGGAGCCCAGGGGCTGG - Intronic
1092487444 12:8914670-8914692 GGGGCGGGGGCGCCGAGGGCGGG - Exonic
1094703934 12:32896838-32896860 GCGGGGGGCGGGCCAGGGGCGGG - Intronic
1095559765 12:43551594-43551616 ACGGCGGGGGCGCAAGGGGCAGG - Intronic
1095743196 12:45629050-45629072 GCTGCTTGGGAGCCTGGGGCAGG + Intergenic
1095945164 12:47749560-47749582 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1096533876 12:52258554-52258576 GGTGCGGTGGCGGCAGGGGCGGG + Intronic
1096946728 12:55414971-55414993 GGGGCGGGGGCGCCGAGGGCGGG + Intergenic
1096983747 12:55743419-55743441 GCGGCGGCGGCGGCAGCGGCGGG + Exonic
1096993270 12:55822059-55822081 GCTGCAGCGGCTCCAGGGGCAGG + Exonic
1097184849 12:57191042-57191064 GCTGAGGGGAGGCCAGGGCCAGG + Intronic
1097264797 12:57738648-57738670 TGTGCGGGGGAGGCAGGGGCGGG + Intronic
1098320536 12:69239502-69239524 GAGGCGCGGGCGACAGGGGCCGG - Intergenic
1101465320 12:104943335-104943357 GCTGAGGAGGCCCCAGGGTCTGG - Intronic
1102037973 12:109782984-109783006 GCCTGGGGGGAGCCAGGGGCAGG - Intergenic
1102047411 12:109838438-109838460 GCTGAGTGGTCGTCAGGGGCTGG + Intergenic
1102219887 12:111187409-111187431 GCAGTGGGGGGGCCAGGGGAGGG - Intronic
1102371016 12:112382319-112382341 GCGGCGGCGGCGGCAGGGCCGGG - Intronic
1102527121 12:113520073-113520095 GCTGGAGAGGCGCGAGGGGCAGG + Intergenic
1102937694 12:116911300-116911322 CCCGCGAGGGCGCCGGGGGCGGG + Exonic
1102948443 12:117011010-117011032 GTTCCTGGGGCGCCCGGGGCTGG - Intronic
1103048777 12:117761234-117761256 GCTGCCGGGGCGATGGGGGCAGG + Exonic
1103177974 12:118880968-118880990 GCTGCAGTGAGGCCAGGGGCTGG - Intergenic
1103479268 12:121240742-121240764 CGTGCGGGGGAGCCGGGGGCGGG + Exonic
1103488196 12:121296741-121296763 GCGGCGGGCGCGCGGGGGGCGGG + Intronic
1103649708 12:122422836-122422858 GCGGCGGGCGCGCCGGGGCCAGG - Intergenic
1103733941 12:123046609-123046631 GCTTAGTGGGTGCCAGGGGCTGG - Intronic
1103781860 12:123404019-123404041 GCTGAGTGGCTGCCAGGGGCTGG - Intronic
1104127485 12:125861663-125861685 GCTGCGGGGACGCCGGGGTTGGG - Intergenic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1104632435 12:130414591-130414613 GCTGCGGCCGTGCCAGGGGCAGG + Intronic
1104845620 12:131845325-131845347 GCTGCAGGGACACCAGGTGCCGG - Exonic
1104969683 12:132525607-132525629 GCTGTCGGGGCGCCTGGGGCCGG + Intronic
1104983279 12:132583259-132583281 GCTGCAGGGGCGCGGGGTGCAGG - Exonic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105031493 12:132887425-132887447 GCTGCGTGGGCGCGGGCGGCCGG - Intronic
1105459168 13:20567363-20567385 GCCCCGGGGCCGACAGGGGCGGG - Intronic
1105472073 13:20703742-20703764 GCGGCGGCGGCGGCGGGGGCCGG + Intronic
1105578506 13:21673966-21673988 GCTGCGGGGACCACGGGGGCCGG + Intronic
1105741437 13:23327730-23327752 GCTGCAGAGGCTCCAGGGACAGG - Intergenic
1105943548 13:25171212-25171234 GCGGCGGGGGCGGCGGGGGGCGG - Exonic
1105943557 13:25171227-25171249 GCGGCGGGGGCGACAGCGGCGGG - Exonic
1106241997 13:27920258-27920280 GCGGCGGCGGCGGCGGGGGCTGG - Exonic
1106308271 13:28532417-28532439 GCTCCGCGGGCGCTCGGGGCTGG - Intergenic
1106503946 13:30355465-30355487 GGTGTGGGGGCTCCAGGGGAGGG - Intergenic
1106776707 13:33016418-33016440 GCTGCGCGGGAGCCAGGCTCCGG - Exonic
1107123495 13:36819725-36819747 GCAGCGGGGGCGCCCGGAGGCGG + Exonic
1107467813 13:40665840-40665862 GCTGCGGTGGCGCTGGGTGCAGG + Exonic
1107787115 13:43968609-43968631 GCGGAGGGGGGGCCAGGTGCTGG - Intergenic
1108313443 13:49217471-49217493 GCTCCTGGGGTGTCAGGGGCTGG - Intergenic
1108408153 13:50124803-50124825 GCTGCGTGGGCACCAGAGCCAGG + Intronic
1113637462 13:111929444-111929466 GCTGCGGAGGTAGCAGGGGCTGG - Intergenic
1113657535 13:112077863-112077885 GCGGCAGGGGCTGCAGGGGCAGG - Intergenic
1113747169 13:112753232-112753254 GATGTGGGGCGGCCAGGGGCGGG - Intronic
1113831225 13:113297331-113297353 GGGGCGCGGGCGCCAAGGGCTGG - Exonic
1116446725 14:45020173-45020195 GCTGAGGAGGCCCCAGGGTCTGG + Intronic
1116448088 14:45035246-45035268 GCTACTGGGGCGACTGGGGCAGG + Intronic
1116958246 14:50944960-50944982 GCTGGGGCGGTGCCAAGGGCTGG - Intergenic
1117092851 14:52267931-52267953 GCTGCTGGCGCGCTCGGGGCTGG + Exonic
1117168246 14:53061920-53061942 GCTACTGGGGAGACAGGGGCAGG + Intronic
1117912443 14:60648552-60648574 CCTGCGGGGGCGGGAGGGGGCGG + Intronic
1118810768 14:69271454-69271476 GCTTCGGGGATCCCAGGGGCCGG - Intronic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1119322453 14:73739900-73739922 GCTGGGGGGGCTGCAGGGGAGGG + Exonic
1119808730 14:77499108-77499130 GCTGCGACGGCGACAGCGGCGGG - Intergenic
1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG + Exonic
1120881223 14:89416811-89416833 GCTCGGGGGGCACCCGGGGCGGG - Intronic
1121439372 14:93939164-93939186 GCTGCGGGGCCGGCGGGTGCGGG + Exonic
1121473440 14:94174233-94174255 GCGGGGGCGGGGCCAGGGGCGGG - Intronic
1121640349 14:95481037-95481059 GCTGCGGGGCTGACTGGGGCAGG + Intergenic
1121674207 14:95739360-95739382 GGTGCTGGGGGGCCAGGGGTAGG - Intergenic
1121781478 14:96624972-96624994 GCTGTGCGAGCACCAGGGGCAGG - Intergenic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122145339 14:99685308-99685330 GCTGCGGGGGGGGCGGGGGGAGG - Intronic
1122425229 14:101601845-101601867 ACTGCTGGGCTGCCAGGGGCCGG - Intergenic
1122445023 14:101761801-101761823 GCCGCGGGGGCGCGACGGCCGGG + Exonic
1122469378 14:101955939-101955961 GCTGCGCGGGCGTCCCGGGCGGG + Intergenic
1122558172 14:102592578-102592600 CCTGCAGGGGCGCCGGGGGAGGG - Intergenic
1122771876 14:104101243-104101265 GCTGCTGGGGCCCCTGGGGAGGG + Intronic
1122853346 14:104548340-104548362 GCTGGGCTGGGGCCAGGGGCTGG - Intronic
1122978627 14:105181319-105181341 GCTCCGTGGGCGCGCGGGGCGGG + Intronic
1122980461 14:105189976-105189998 GGGGTGGTGGCGCCAGGGGCTGG + Intergenic
1123024919 14:105420000-105420022 GCGGCGGAGGGGCCCGGGGCGGG - Exonic
1123039959 14:105486452-105486474 GCTGCGGGGGCTGCGGGGGCTGG - Intergenic
1124372777 15:29112870-29112892 AGTGGGGGGCCGCCAGGGGCTGG - Intronic
1124439475 15:29675817-29675839 GGTGCAGGGGCGCCGAGGGCTGG - Intergenic
1124469296 15:29968884-29968906 GCTGCGGGTGCGGCGGGCGCGGG - Intergenic
1125300773 15:38252264-38252286 GCTGCGGCGGCGGAAGGAGCGGG + Intergenic
1125462677 15:39920993-39921015 GCAGCCTGGGCGCGAGGGGCGGG - Intergenic
1125599828 15:40909394-40909416 GCTGCTTGGGCGCCAGGCCCTGG - Intergenic
1128322063 15:66701285-66701307 GCCGCGCCGGCTCCAGGGGCAGG + Intergenic
1128459917 15:67859341-67859363 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1128510969 15:68313747-68313769 GCTCCGGGGGCCCCAGGAGAGGG - Intronic
1128818959 15:70635104-70635126 GCTTCGTGGTTGCCAGGGGCTGG - Intergenic
1129082495 15:73052741-73052763 GCTGCTCGGGCGCCGGGCGCCGG + Exonic
1129503245 15:76059911-76059933 GCGGCGGGGCCGCGAGGGGGCGG + Exonic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129893786 15:79089490-79089512 GCGGCGGCGGCGCAGGGGGCGGG + Intronic
1130613362 15:85380919-85380941 GCTGCGGGGGTTTCGGGGGCGGG + Intronic
1131019862 15:89088708-89088730 GCCGTGGGGGTCCCAGGGGCTGG + Intronic
1131043586 15:89295720-89295742 GTGGGGGGGGCGCCAGGGGAAGG - Intronic
1131064266 15:89423573-89423595 GCTGAGGGTGGGTCAGGGGCAGG - Intergenic
1131087211 15:89587225-89587247 GCTGTGGGAGAACCAGGGGCTGG + Intronic
1131157594 15:90084703-90084725 GCTGCAAGGGGGCCTGGGGCAGG - Intronic
1131484418 15:92808610-92808632 GCTGGGGAGGCGCACGGGGCGGG - Intronic
1131817032 15:96232785-96232807 GCTACGGGGGCTTCAGGGTCTGG - Intergenic
1132398280 15:101489699-101489721 GCTGCGAGTGCGCCGGGGGGTGG + Exonic
1132452534 15:101976203-101976225 GCTGCGGTGGCGGCAGAGGAGGG - Intergenic
1132454364 16:14419-14441 GCTGCGGTGGCGGCAGAGGAGGG + Exonic
1132464903 16:72782-72804 CCTGCGGGGACACCTGGGGCTGG + Intronic
1132500617 16:283144-283166 GCTGCCAGGGCGCGTGGGGCGGG - Exonic
1132501267 16:285793-285815 TCTGCGGGGCCTGCAGGGGCAGG - Intronic
1132578723 16:675621-675643 GCGGCGTGTGCGGCAGGGGCGGG + Intronic
1132674232 16:1115038-1115060 GCTGAGGGGGCACCAGGCCCTGG + Intergenic
1132698898 16:1213946-1213968 GCCGCGAGGGGCCCAGGGGCTGG + Intronic
1132747568 16:1443353-1443375 GCTGGGTGGACTCCAGGGGCAGG - Intronic
1132756211 16:1486712-1486734 GCTGCAGGGGAGCCATCGGCAGG - Intronic
1132778865 16:1612310-1612332 GGTGCGCGGGCGCGCGGGGCGGG - Exonic
1132805078 16:1771566-1771588 GGGGCGGTGGCGCCCGGGGCGGG + Exonic
1132850004 16:2020632-2020654 GGCGCGGAGGCGCCACGGGCGGG - Exonic
1132933918 16:2471669-2471691 GCTGCGGGTCAGCCAGTGGCCGG - Exonic
1132987871 16:2777353-2777375 GCTGCGGGGCGGCACGGGGCGGG - Intergenic
1133144074 16:3770662-3770684 GCTGCGGGGTCACCTGGGCCTGG + Exonic
1133184207 16:4083829-4083851 GCTTAGGGGCTGCCAGGGGCTGG + Intronic
1133513425 16:6483223-6483245 GCCACGGCGGCGCCAGGGCCCGG - Intronic
1134829699 16:17313207-17313229 GTTGCCAGGGCTCCAGGGGCAGG - Intronic
1136218839 16:28814439-28814461 GCTACGCGGGAGGCAGGGGCAGG - Intergenic
1136234064 16:28903781-28903803 GCTGAGGGGGCGCGGGTGGCAGG - Intronic
1136398879 16:30007138-30007160 GCTGCAGGGGCGCCAGGGGAGGG - Intronic
1136492447 16:30618218-30618240 ACTGCTGGAGCGCCAGGGTCAGG - Intronic
1136500811 16:30668997-30669019 GCTGAGGGTGGGGCAGGGGCAGG - Intronic
1136534930 16:30893824-30893846 GCTGCTCGGGGGCCAGGGACGGG - Intronic
1136609348 16:31356877-31356899 GCTGCGGGAGTGCGATGGGCGGG - Intronic
1137053939 16:35734636-35734658 GCTGCTGTGGCACCAGGGGCTGG - Intergenic
1137267977 16:46884360-46884382 GCGGCGCGGGCGCCGGGCGCGGG + Exonic
1137454785 16:48609987-48610009 CCCGCGGCGGCGCCGGGGGCCGG + Exonic
1137513568 16:49123022-49123044 CCTACGGGAGGGCCAGGGGCTGG - Intergenic
1137531575 16:49281768-49281790 GCGGCGGCGGCGGCAGCGGCGGG - Exonic
1138247627 16:55479284-55479306 GCGGCGGCGGCGGCGGGGGCTGG + Exonic
1138514566 16:57528988-57529010 GCAGCGCGGGCGCGGGGGGCAGG + Exonic
1139023319 16:62780311-62780333 CCTGAGGGGGCCCCAGGGGGTGG - Intergenic
1139570103 16:67806459-67806481 CCGGCGGGGGCGCTGGGGGCGGG - Exonic
1139573665 16:67828317-67828339 GCTGCCGGTACTCCAGGGGCAGG + Exonic
1139598116 16:67969628-67969650 GCTGCGGGGGCCCTGGGGGAGGG - Intergenic
1139676449 16:68526985-68527007 GCTGCGCAGGAGCCTGGGGCGGG - Intergenic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1139937135 16:70579683-70579705 GCTGCCTGGGAGCCAGGGCCTGG + Intergenic
1139965267 16:70741881-70741903 GCTGCTTGGGCGGCAGGGCCAGG - Intronic
1140025720 16:71289070-71289092 CCAGCGGGTGAGCCAGGGGCTGG - Intronic
1140223135 16:73058245-73058267 GCGGCGGCGGCGGCAGCGGCGGG + Intronic
1140663936 16:77212254-77212276 GGTGGGCGGGCGTCAGGGGCAGG - Intronic
1141501598 16:84448616-84448638 TCTGCTGGGGCGTCAGCGGCAGG - Exonic
1141623733 16:85250448-85250470 GGGGCGGAGGCGCCAGGGCCAGG + Intergenic
1141840117 16:86568553-86568575 GCTGCGGCGTCGGCTGGGGCTGG - Exonic
1141946934 16:87317142-87317164 GCTGCCGGGGGGCCGGGCGCGGG - Exonic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1141982079 16:87556943-87556965 GATGCCAGGGCCCCAGGGGCAGG + Intergenic
1142142371 16:88478348-88478370 GCTGCGGGTGGGCCAGGGGTGGG + Intronic
1142352693 16:89587240-89587262 ACTGAGGGGGCGGGAGGGGCGGG - Intronic
1142374971 16:89701993-89702015 GCGGCCGGGTCGCCTGGGGCTGG - Intergenic
1142429678 16:90019386-90019408 GCTGTTGGGGCGCCCGGGCCAGG - Intronic
1142429728 16:90019529-90019551 GCTGGGGGGGCGCCGGGAGGGGG - Intronic
1142451024 16:90173256-90173278 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1142456539 17:60439-60461 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1142592398 17:1012098-1012120 GCTGGGGCGGGGGCAGGGGCAGG + Intronic
1143063351 17:4222196-4222218 GGGGCGGCGGCGCCAGGCGCGGG - Intronic
1143108166 17:4539683-4539705 CGGGTGGGGGCGCCAGGGGCTGG + Exonic
1143478826 17:7217409-7217431 GGGGCGGGGGCACCGGGGGCTGG + Intronic
1143562629 17:7704854-7704876 GCTGCGGGAGCGAAAGGGGTGGG + Intergenic
1143590783 17:7885058-7885080 GCGGCGGGGGCGGCGGCGGCGGG - Exonic
1143618418 17:8067333-8067355 GCTGAGCGGGCGCCAGTGGAGGG + Intergenic
1143758806 17:9086254-9086276 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
1143762588 17:9115955-9115977 GGGGCGGAGGCCCCAGGGGCAGG + Intronic
1144154437 17:12485416-12485438 GCTCCAAGGGCCCCAGGGGCAGG + Intergenic
1144739374 17:17572671-17572693 GCTGCGTGAGGGCCAGGGGCCGG + Intronic
1144781212 17:17809581-17809603 GCGGCGGGGGCTCCTGGGGGTGG - Intronic
1145018249 17:19412540-19412562 GCTCCCGGGGCGCCATGGGCTGG - Exonic
1145828243 17:27893334-27893356 GCCGCGGCGGCGTCCGGGGCTGG - Exonic
1146167381 17:30600614-30600636 ACGGCTGGGGCGCCAGCGGCCGG + Intergenic
1146219786 17:31008494-31008516 GCTGCGGAGGCGCGGGCGGCCGG + Intergenic
1146255885 17:31391532-31391554 GCGGCGGGGGCGGCGGCGGCGGG - Intergenic
1147162971 17:38578688-38578710 GCGGCGGGGGCAGCGGGGGCCGG - Exonic
1147168660 17:38605854-38605876 GCTGGGAGGGCGCCGGCGGCCGG + Exonic
1147360599 17:39927397-39927419 GCTGGGGAGGCGCCCCGGGCTGG - Intronic
1147769395 17:42857110-42857132 GCTGGGGGAGTACCAGGGGCTGG - Exonic
1148060095 17:44830228-44830250 GCGGCGGCGGCGGCAGCGGCGGG - Intronic
1148107296 17:45125846-45125868 GCTGGGAGGGTACCAGGGGCTGG + Intronic
1148177795 17:45582855-45582877 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1148178129 17:45585028-45585050 GCAGTGGGGGCGGCTGGGGCCGG + Intergenic
1148324168 17:46773632-46773654 GCTGAGGGGGGGGGAGGGGCTGG - Intronic
1148460921 17:47838571-47838593 GCTGCGTGGGATCCTGGGGCAGG + Exonic
1148542598 17:48492479-48492501 GCTGCGGTGGGGGCTGGGGCTGG - Intergenic
1148786840 17:50149739-50149761 GCGGCGGCGGCGGCGGGGGCTGG + Exonic
1148929956 17:51120295-51120317 TCTCCGGGGGCGGCCGGGGCGGG - Intronic
1149451256 17:56751744-56751766 GCTGCAGGGAGGCCAGAGGCAGG - Intergenic
1149585300 17:57782426-57782448 GCTGTGGTGGCGCCAGGCTCAGG + Intergenic
1149614813 17:57988433-57988455 GCTGGGGTGGGGCCCGGGGCGGG + Intergenic
1150408025 17:64919318-64919340 GCAGTGGGGGCGGCCGGGGCCGG + Intronic
1150488913 17:65561348-65561370 GCGGCGTGGGCGCGGGGGGCGGG - Intronic
1150561968 17:66302488-66302510 GCGGCGGGGGCGCGCGGGCCGGG - Intergenic
1150643528 17:66964816-66964838 GCTCCGGGGGCGCCGGGGTTGGG - Intergenic
1151439665 17:74120026-74120048 GCTGAGGGGGCTCCAGGTGGAGG + Intergenic
1151553587 17:74835659-74835681 GCTGCAGTGGGGCCAGTGGCAGG - Intronic
1151747844 17:76021411-76021433 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1151783785 17:76265433-76265455 GCTGCGCGGGCGCGGGAGGCCGG - Exonic
1152227107 17:79097614-79097636 GCTCCGGGGGCTCTGGGGGCGGG - Intronic
1152236600 17:79142289-79142311 GCTGCGGAGCCTCCAGGGGTGGG + Intronic
1152357328 17:79813503-79813525 GCGGCGGGGGCGGCGGGCGCGGG + Intergenic
1152366712 17:79860608-79860630 TCTGCGGTGGAGACAGGGGCTGG + Intergenic
1152461943 17:80446162-80446184 GCTTGGGGGGCAGCAGGGGCAGG - Intergenic
1152642778 17:81456109-81456131 GCAGCGTAGGCTCCAGGGGCAGG + Intronic
1152751773 17:82065650-82065672 GCTCCGAGGGCGCCGGGTGCCGG + Intronic
1152795503 17:82304310-82304332 GCTGAGGGGGCCCCTGGGGCTGG + Intergenic
1152810548 17:82379870-82379892 GCTGCGGGGTCGCCAGCGGGCGG - Intergenic
1152911962 17:83010110-83010132 GCTGCGGGGGCCCCTGGTGTGGG + Intronic
1153457560 18:5296393-5296415 GCTGCGCCGGCGCCGGGCGCGGG - Intronic
1153522985 18:5969361-5969383 GCTGCTGGGGGGCCAGGGCTGGG - Intronic
1153591925 18:6683305-6683327 GCTGCGCAGAAGCCAGGGGCGGG - Intergenic
1153794454 18:8609644-8609666 GCCGAGGGGGCGCCGGGGCCCGG + Exonic
1153821535 18:8836567-8836589 GATGAGTGGGTGCCAGGGGCTGG - Intergenic
1153935220 18:9914589-9914611 GCGGCGGCGGCGCCAGGGCCGGG - Intronic
1154202460 18:12308599-12308621 GCCGCCGGGGCGCCTGGGGTGGG + Intronic
1154214869 18:12408306-12408328 GGAGCGGGGGCGGCCGGGGCGGG + Intronic
1155653955 18:28175595-28175617 GCTGGGGCGGGGGCAGGGGCTGG - Intronic
1156099628 18:33578368-33578390 GCGGCGGGCGGGCCGGGGGCGGG - Intergenic
1156294027 18:35773877-35773899 GCTGCTGGGGCCCCTGAGGCTGG - Intergenic
1156476719 18:37410176-37410198 GCTGCCAGGGAGGCAGGGGCGGG - Intronic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1157763592 18:50282016-50282038 GCTGTGGGAGCGCGCGGGGCGGG + Intergenic
1157867206 18:51197248-51197270 GCGGCGGGGGCGGCTGCGGCAGG + Exonic
1158648596 18:59268115-59268137 AGAGCGGGGACGCCAGGGGCCGG + Exonic
1158976713 18:62716487-62716509 GCTCCGGGGGCGCCAGCCGGGGG - Exonic
1159947617 18:74456433-74456455 GCTGCGGAGGCGGCTGGGACCGG - Intronic
1160186797 18:76682134-76682156 GTGGAAGGGGCGCCAGGGGCTGG - Intergenic
1160555339 18:79721000-79721022 AATGAGGGGGCGCCTGGGGCAGG + Intronic
1160646457 19:195792-195814 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1160722891 19:604977-604999 GCAGTGGGGGCGCACGGGGCTGG + Intronic
1160726747 19:620878-620900 GACGTGGGGGCGCCAGGGGAGGG + Intronic
1160726790 19:620968-620990 GGCGCGGGGGCGCCGGGGGAGGG + Intronic
1160726801 19:620989-621011 GGCGCGGGGGCGCCGGGGGAGGG + Intronic
1160747495 19:718983-719005 GGTGCGGGGGCAGCAGGGGATGG - Intronic
1160780922 19:877716-877738 GCTGCTGGGGCACGTGGGGCAGG - Intronic
1160780948 19:877790-877812 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160780980 19:877902-877924 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781002 19:877970-877992 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781020 19:878032-878054 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781060 19:878182-878204 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781085 19:878250-878272 GCTGCTGGGGCCCGTGGGGCTGG - Intronic
1160781102 19:878306-878328 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781124 19:878374-878396 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781151 19:878448-878470 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160781168 19:878504-878526 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781204 19:878628-878650 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781238 19:878740-878762 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781257 19:878796-878818 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781282 19:878864-878886 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781353 19:879074-879096 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781378 19:879142-879164 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781419 19:879318-879340 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781450 19:879430-879452 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781467 19:879486-879508 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781503 19:879622-879644 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781519 19:879678-879700 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781543 19:879766-879788 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781561 19:879822-879844 GCTGCTGGGGCACGTGGGGCTGG - Intronic
1160781586 19:879910-879932 GCTGCTGGGGCACGTGGGGCCGG - Intronic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1160798226 19:955374-955396 CCTGCGGGGGCCCCAGCTGCTGG - Intronic
1160864099 19:1249592-1249614 GCTGCGGGCGCGGGCGGGGCGGG + Intronic
1160864441 19:1250724-1250746 GCTGCGAGGGCGTCCCGGGCCGG + Intronic
1160876200 19:1297200-1297222 GCTGCAGGGGGGCCAGTGCCTGG + Intronic
1160896357 19:1403955-1403977 GGGGGGGGGGTGCCAGGGGCTGG + Intergenic
1160905591 19:1450298-1450320 GCTGGCGGGGCGCCTGGGTCTGG - Intronic
1160991817 19:1863274-1863296 GCCGCGGCGGCGCCGGGGCCCGG + Exonic
1161009979 19:1955316-1955338 GCTGCGAGGGCCTCAGGCGCAGG + Intronic
1161012518 19:1967525-1967547 GCTGCGGTGGCTCCCGGTGCAGG + Intronic
1161083849 19:2324851-2324873 GATGCGTGGGTGCCAGGGCCAGG + Intronic
1161088092 19:2344250-2344272 GATGGGGGGGTGCAAGGGGCAGG - Intronic
1161135019 19:2614459-2614481 GATGTGTGGGTGCCAGGGGCTGG - Intronic
1161343300 19:3754173-3754195 GGTGAGGGGGCGGCCGGGGCCGG - Exonic
1161374226 19:3930998-3931020 GACGCGTGGGTGCCAGGGGCTGG - Intergenic
1161612486 19:5250934-5250956 GGTGCGGGGGCGGCGGGGGGGGG + Intronic
1161686831 19:5707062-5707084 GCTGCAGCAGCGCCTGGGGCGGG - Exonic
1162059332 19:8085454-8085476 GCTGTGGGGGTGGCCGGGGCTGG - Exonic
1162100216 19:8334652-8334674 GCTGCGGAGGAGGCAGCGGCGGG - Exonic
1162312424 19:9914820-9914842 GATGCGGGGACGCCAGGAGGGGG - Intronic
1162315500 19:9936176-9936198 GCTGCAGGGCGGCGAGGGGCGGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162778628 19:12995504-12995526 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
1162925146 19:13927101-13927123 GCTGGGTGGGCTCCAGGGGAGGG + Intronic
1162959469 19:14117549-14117571 GCGGCGGCGGCGGCCGGGGCCGG + Exonic
1163111118 19:15161387-15161409 GCCGCAGGGGCCCCGGGGGCGGG - Exonic
1163368687 19:16889988-16890010 GCAGCGGGTGCACCAGGGCCAGG - Exonic
1163563902 19:18038311-18038333 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
1163604697 19:18267526-18267548 CCTGTGGGGGCGGCAGGGGGTGG + Exonic
1163607138 19:18281572-18281594 GCTGCGGCCGCGGCCGGGGCGGG - Exonic
1163613203 19:18311457-18311479 GCTGCGTGGTCTCCAGGGGTTGG - Intronic
1163613351 19:18312090-18312112 GCTGCTGGGTCGGCCGGGGCTGG - Intronic
1163617939 19:18340779-18340801 ACTGCGGGGCCGAGAGGGGCAGG + Intronic
1163689760 19:18732083-18732105 GATGCTGGGCCCCCAGGGGCAGG + Intronic
1163767243 19:19170436-19170458 GATGCTGGGGCGCCATGGGTGGG + Intronic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1165049856 19:33134552-33134574 CCTGCAGGGGCGGCAGGGGCTGG + Intronic
1165157223 19:33796044-33796066 GCCGCCGCGGCGCCCGGGGCTGG - Intronic
1165199792 19:34134474-34134496 GCTGGGGTGGGGCTAGGGGCCGG + Intergenic
1165204565 19:34172629-34172651 GCGGCGGCGGCGCCATGAGCGGG + Exonic
1165256054 19:34577803-34577825 GCTGGGGGCGGGGCAGGGGCGGG - Intergenic
1165330384 19:35138698-35138720 GCTGGAGGGGGGCCAGGGGGCGG - Intronic
1165468188 19:35987397-35987419 GGGGCGGGGGCCGCAGGGGCAGG - Intergenic
1166083259 19:40458288-40458310 GCGGCAGGGGTGGCAGGGGCGGG + Intronic
1166231417 19:41427440-41427462 GCAGGGAGGGCCCCAGGGGCCGG + Exonic
1166301891 19:41915761-41915783 GCCAGGGGGGCGCCAGGGGCAGG - Intronic
1166334340 19:42096195-42096217 GCTGCGGGTGCGAGAGGTGCGGG + Exonic
1166546992 19:43639782-43639804 GCGGCGGCGGCACCATGGGCCGG - Exonic
1166677478 19:44748627-44748649 GCCCCGGGGGGGCCGGGGGCGGG + Exonic
1166802950 19:45469310-45469332 GCTCCCGGGACGTCAGGGGCGGG - Intronic
1166828081 19:45621637-45621659 CCTGCAGGGTGGCCAGGGGCAGG + Exonic
1166852847 19:45768687-45768709 GCGGCGGCGGCGGCCGGGGCCGG - Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166873595 19:45884640-45884662 GCGGCGTGGGCGCCAGGTTCCGG + Exonic
1166876537 19:45901385-45901407 GGTGTGGCGGCGCCGGGGGCAGG - Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167293262 19:48635850-48635872 CCCGCGGGGGCGCCCGGGGCCGG - Exonic
1167374142 19:49102270-49102292 GCTACGGGGGCGACTGGGGTGGG - Intronic
1167428440 19:49441477-49441499 GCTGCGGGGCCGGCCGGGCCGGG - Exonic
1167665505 19:50821020-50821042 GGTGCGGGCTCCCCAGGGGCAGG + Intronic
1167846753 19:52171132-52171154 GCTCCGGGGTCGCAACGGGCGGG + Intronic
1168059549 19:53883296-53883318 GGCGCGGGGGAGCCCGGGGCGGG + Intronic
1168277428 19:55285362-55285384 GCTGGAGGGGCTCCAGGGCCAGG + Intronic
1168287379 19:55341356-55341378 GCTGCCGGGGAGGCAGGGGGCGG + Intronic
1168343749 19:55640856-55640878 GGAGCGGGGCCGCCGGGGGCGGG + Intronic
1168645985 19:58059585-58059607 GCAGAGGTGGGGCCAGGGGCGGG - Intronic
925226635 2:2189188-2189210 GCTGCGGTGGCGGCATGGCCAGG - Intronic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
925948899 2:8893038-8893060 ACTGTGGGGGCACCAGAGGCAGG + Intronic
926575430 2:14575488-14575510 GCTGCTGGCTCCCCAGGGGCAGG - Intergenic
928085736 2:28345217-28345239 GCTGAGGGGGCCCCTGGGCCTGG - Intergenic
928332281 2:30366770-30366792 GCTGGGTGGGCCCCAGGTGCAGG - Intergenic
928511909 2:32010541-32010563 GCAGCGGGGACGCCGGGGGCCGG - Exonic
929701843 2:44169102-44169124 GCGGCGGCGGCGTGAGGGGCCGG + Exonic
930221972 2:48754895-48754917 GGTGCGCGGGTGCCAGCGGCAGG + Intronic
931052318 2:58428524-58428546 GCTCCGGGGCCGCCGGGGGCGGG - Intergenic
931763050 2:65433012-65433034 GCGGCGCAGGTGCCAGGGGCTGG + Intergenic
932036685 2:68252738-68252760 GGTGGGGGGAGGCCAGGGGCGGG + Intronic
932331461 2:70900536-70900558 CGAGCGGGGGCGCGAGGGGCGGG + Intergenic
932480730 2:72037481-72037503 GCTGCGGATGCTCCAGGGGTAGG + Intergenic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
932692573 2:73925874-73925896 GCTGGGGAGGGGCCGGGGGCTGG - Intergenic
934113839 2:88765705-88765727 GCTGCGGAGGCGCAGCGGGCTGG - Intergenic
934178803 2:89601360-89601382 GCTGGGTGAGTGCCAGGGGCAGG - Intergenic
934289090 2:91675646-91675668 GCTGGGTGAGTGCCAGGGGCAGG - Intergenic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
935161508 2:100533422-100533444 CCTGTTGGGGCGGCAGGGGCAGG - Intergenic
935237604 2:101151480-101151502 GCTGGAGAGGGGCCAGGGGCGGG - Intronic
936568746 2:113598677-113598699 GCTGCGGTGGCGGCAGAGGAGGG - Intergenic
937079315 2:119128838-119128860 ACTGGGGAGGCGCCTGGGGCAGG + Intergenic
937295814 2:120809336-120809358 GATGAGGAGGTGCCAGGGGCTGG + Intronic
937301887 2:120847742-120847764 GCTGCGTGGGGGGCAGGGGCGGG + Intronic
938307790 2:130266678-130266700 GCTGGAGGGCAGCCAGGGGCAGG - Intergenic
938447547 2:131390163-131390185 GCTGGAGGGCAGCCAGGGGCAGG + Intergenic
938465575 2:131522626-131522648 GATGCGGAGGTGCAAGGGGCAGG - Intergenic
938468198 2:131536369-131536391 GGTGCGTGGGCTCCAGGGGTGGG + Intergenic
938831248 2:135052219-135052241 GGGGCGGGGGCTCCGGGGGCGGG + Intergenic
940883293 2:158968470-158968492 GCTGCGGCGGATCCAGGGACCGG - Intergenic
941029374 2:160493676-160493698 GCTCCGGGGCTGCCAAGGGCTGG + Exonic
942277972 2:174336425-174336447 GCTGCCGCGGCGGCAGCGGCCGG + Exonic
942446141 2:176080242-176080264 GCGGCGGGGGCGCCGGGGCCGGG - Exonic
942454826 2:176130415-176130437 GCTGCGGCGGCGGCGGCGGCGGG + Exonic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
944096773 2:195976445-195976467 GCTGCCTGGGAGCCAGGGCCTGG - Intronic
944114502 2:196171848-196171870 GCAGAGGGGGCGCGCGGGGCTGG + Intronic
944715903 2:202376171-202376193 GCGGCGGCGGCGCCGGCGGCGGG - Intergenic
945033521 2:205685687-205685709 CTGGCGGGGGCGCCCGGGGCAGG - Intronic
945466003 2:210171287-210171309 GCGGCGGCGGCGGCCGGGGCGGG - Exonic
945699417 2:213151723-213151745 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
946277508 2:218642551-218642573 TCTGCAGGAGAGCCAGGGGCAGG + Exonic
947545393 2:231006937-231006959 GCTGCAGGGGCCCCCGGGGAAGG + Intronic
947623430 2:231604917-231604939 GCTGCGGAGCCTCCAGGGTCTGG + Intergenic
947629794 2:231644743-231644765 GGGGTGGGGGCGGCAGGGGCTGG - Intergenic
947748877 2:232522788-232522810 GCTCCTGGGGCTCCTGGGGCAGG - Exonic
948046851 2:234951932-234951954 GGGGCGGGGGCGCGGGGGGCGGG - Intergenic
948505670 2:238425882-238425904 GCTGTGGTGGAGCCAGGGGCTGG + Intergenic
948776213 2:240290260-240290282 GCTGAGGGGGCCCCAGAGGCAGG - Intergenic
948829973 2:240593949-240593971 CCTGCGGGAGCTCCAGGGTCAGG + Exonic
948843732 2:240672980-240673002 GCTGCAGCGGCGCCAGCTGCGGG - Intergenic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
948953999 2:241272909-241272931 GCGGCGGGGACCCCAGCGGCGGG - Intronic
948989147 2:241543031-241543053 GCTGGGCGGGAGCCAGAGGCTGG - Intergenic
949043459 2:241859607-241859629 GCTGGGGCGGTGGCAGGGGCTGG + Intergenic
1168837243 20:885393-885415 GCTGCAGGGACTCCAGGGCCGGG - Intronic
1168961678 20:1874439-1874461 GCTGTGGGGGCTGCAGGGGTGGG - Intergenic
1168965092 20:1894255-1894277 GGCGCGGGGGCGCGGGGGGCGGG - Exonic
1169081604 20:2800661-2800683 GCTGCGGAGGGGCGGGGGGCAGG - Intergenic
1170554407 20:17504144-17504166 GCTGTGGGGGCGCCCAGGACAGG - Intronic
1171879863 20:30610758-30610780 GCTGGGATGGCTCCAGGGGCTGG - Intergenic
1172010993 20:31845502-31845524 GTTGTGGGGGCGCCAGGCCCGGG + Exonic
1172113266 20:32559873-32559895 GCCGCGTGGGCGGCAGGGCCTGG - Intronic
1172474534 20:35226895-35226917 GCGGCGGCGGCGGCGGGGGCAGG + Exonic
1172517036 20:35542168-35542190 CCTGCGGGGGCGCCACCGGTAGG + Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172596588 20:36154693-36154715 GCTCGGCGTGCGCCAGGGGCTGG - Intronic
1172684907 20:36746110-36746132 GCGGCGGCGGCGAGAGGGGCGGG + Intergenic
1173210635 20:41029112-41029134 GGTCCGGGGCCGCCAGGGTCAGG - Intronic
1173243387 20:41317465-41317487 GCCGCGGGGGCACGCGGGGCCGG + Intronic
1173475341 20:43355232-43355254 GCTGCTGGGTTTCCAGGGGCTGG - Intergenic
1173728377 20:45312298-45312320 GCTGCGCGGGGGCCGGGAGCTGG + Exonic
1173729215 20:45316995-45317017 GCTGCGCCCGCGCCAGGCGCGGG + Exonic
1173958862 20:47055951-47055973 GTGGCGGGGGCAGCAGGGGCGGG - Intronic
1174541562 20:51293562-51293584 CCTTCGGGGGCTCCATGGGCTGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175429523 20:58891673-58891695 GCTGCGGCGGCGGCGGGCGCGGG - Intronic
1175448477 20:59042793-59042815 GCTGGGGGCGGGGCAGGGGCAGG - Exonic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175831076 20:61965795-61965817 GCCGAGGAGGAGCCAGGGGCGGG - Intronic
1175847108 20:62065008-62065030 GCGGCGGGGGCGGCGGGCGCGGG + Exonic
1175905342 20:62376811-62376833 GATGAAGGGGCTCCAGGGGCAGG - Intergenic
1175989243 20:62779299-62779321 GCTGTGGGGGCTGCAGGGGGTGG - Intergenic
1176077159 20:63253840-63253862 GCGGCGGGGGCGGGCGGGGCCGG + Intronic
1176207202 20:63895451-63895473 GCTGCGCGGGCGCTCGGGGCCGG + Intronic
1176219695 20:63964076-63964098 GCTGGGTGGGCCACAGGGGCCGG + Exonic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176547122 21:8206868-8206890 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1176555027 21:8251077-8251099 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1176566073 21:8389915-8389937 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1176573949 21:8434101-8434123 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1177054412 21:16282826-16282848 GCTTCCGGGGGGCCAGGGGATGG + Intergenic
1178513820 21:33229880-33229902 GCGGGGGCGGAGCCAGGGGCGGG - Intronic
1178839917 21:36130173-36130195 GCAGCGGGGACGCCGGGGGCCGG + Intergenic
1178865101 21:36320415-36320437 GCTGCGGCGGGGCCCGGGGAGGG + Intronic
1178915003 21:36701165-36701187 GCTCCCGGGGCTCCAGAGGCCGG - Intronic
1178992561 21:37367479-37367501 GCTGCGGCGCGGCCAGGAGCCGG + Intronic
1179422407 21:41247333-41247355 GCTGCAGCTGCGCCAGTGGCTGG - Intronic
1179512048 21:41879477-41879499 GCAGCGGGCGCGCGCGGGGCGGG + Exonic
1179731521 21:43370557-43370579 GCCGCTGGGGCCCCAGGGGAGGG - Intergenic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179988162 21:44932489-44932511 GCTGGGAGGGCGTCTGGGGCCGG + Intergenic
1180000140 21:44991793-44991815 GCAGCAGGGGCTCCAGGGTCCGG + Intergenic
1180080118 21:45482852-45482874 ACTGAGTGGGCACCAGGGGCAGG - Intronic
1180095928 21:45555302-45555324 GCGGCGGGGGCGGCGGGGGGCGG + Intergenic
1180228295 21:46411515-46411537 GCTGCAGGGCCTCCAGGGCCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180891409 22:19291660-19291682 GCGGCGGCGGCGGCAGCGGCAGG + Exonic
1180951449 22:19722349-19722371 GCGGCGGGGGCGGCGGAGGCGGG + Intronic
1180951722 22:19723476-19723498 GGTGCGGGCGTGGCAGGGGCGGG + Exonic
1180962170 22:19766965-19766987 GCCGCGGTGGCCCCTGGGGCTGG - Exonic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181022801 22:20112506-20112528 GCTCCCAGGGCCCCAGGGGCGGG - Exonic
1181051014 22:20238299-20238321 ACTGCGGCGGCGGCAGGGGTGGG - Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181283444 22:21735911-21735933 GGGGCGGGGGCGCGCGGGGCAGG - Intergenic
1182278622 22:29205815-29205837 GCAGCGGCGGCGCAGGGGGCGGG + Intergenic
1183280702 22:36930572-36930594 TCTGCTGGGGCCCCAGGGACAGG - Intronic
1183444423 22:37843875-37843897 GCGGCGCGGGGGCCCGGGGCGGG - Intronic
1183630591 22:39030228-39030250 GCTGTGGGGGCGGCAGGGTGAGG - Intronic
1183634047 22:39050320-39050342 GCTGTGGGGGCGGCAGGGTGAGG - Intronic
1184075537 22:42174921-42174943 GCTGCTGGGGCGGCTGAGGCAGG + Intronic
1184236873 22:43187362-43187384 GCAGGGGGCGCGGCAGGGGCGGG - Intergenic
1184278600 22:43424936-43424958 GCTGCGGTGGCGGCAGCGGTGGG + Exonic
1184694756 22:46133148-46133170 GCTGTGGGGGCTGCTGGGGCTGG + Intergenic
1184711221 22:46250499-46250521 GCTGCGGGAGCGCGCGGGCCTGG + Exonic
1184759602 22:46537155-46537177 GCGGCGGCGGCGCCATGGCCCGG + Exonic
1184795133 22:46727837-46727859 GCCGCGGGGGTGGCAGGGCCGGG - Intronic
1185227533 22:49661395-49661417 GCTGTGGGGGCTGCAGGAGCTGG - Intergenic
1185272072 22:49934425-49934447 GCTGAGGGAGCAGCAGGGGCAGG - Intergenic
1185282999 22:49983647-49983669 GCTGCGGGGGCGGGAGGAGGGGG - Intergenic
1185292815 22:50035635-50035657 GCTTCAGGGGCGCGGGGGGCTGG - Intronic
1185324233 22:50217871-50217893 GCTGCGGGGGGGCCAGGGCGGGG - Intronic
1185371207 22:50461754-50461776 GCTGCGGGGGCCCAAGGCCCGGG - Intronic
1185402721 22:50627095-50627117 GCTGCGGGAGCATCAAGGGCTGG + Intronic
1203251997 22_KI270733v1_random:123153-123175 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1203260051 22_KI270733v1_random:168236-168258 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950147791 3:10664210-10664232 GCTGCGGGGGTGACAGCTGCAGG - Intronic
950282404 3:11719459-11719481 CCTGCGGGGGACCCAGGGGCGGG + Intronic
950436519 3:12983594-12983616 GCTGAGTGGGCTCCAGGGGCTGG - Intronic
950473983 3:13204258-13204280 GCAGCGCGGGCGCCAGCGCCAGG + Intergenic
951078694 3:18425781-18425803 GGCGCGCGGGCGGCAGGGGCAGG + Intronic
951982079 3:28576379-28576401 GCTGAGGCGGCGGCTGGGGCTGG - Intergenic
952451747 3:33439994-33440016 GCTGCGGGGGCCCCACTGGCAGG + Exonic
952882673 3:37994470-37994492 AGTGCGGGGGCGACCGGGGCAGG + Intronic
953406978 3:42664505-42664527 GGGGCGGGGGCGGCAGGGTCTGG - Exonic
953801088 3:46023130-46023152 GCGGCGGCGGCGCAGGGGGCGGG + Intronic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954412778 3:50378236-50378258 CCTGCAGGGAAGCCAGGGGCTGG + Intronic
954437491 3:50503734-50503756 GCGGCGGGGGCGCGCGGGGGCGG - Intronic
954468869 3:50674948-50674970 GCCGCGGCGGCGCCGGGAGCCGG + Intergenic
954715257 3:52523732-52523754 GCTGTGGGGGTGCCAGGAGGGGG - Exonic
959587713 3:108040663-108040685 GCTGCCTGGGAGGCAGGGGCTGG + Intergenic
960096751 3:113696665-113696687 GCTGCGGCCGCGGGAGGGGCGGG - Intergenic
960338345 3:116445553-116445575 GCTGAGAGAGCGCCAGGGACTGG - Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961081618 3:124033202-124033224 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
961674391 3:128555799-128555821 GAGGGGGGGGCGCCCGGGGCAGG + Intergenic
961780203 3:129316547-129316569 GCTGCGGGAGCGCGAGAGGAGGG + Intergenic
961827165 3:129605278-129605300 GCGGCGGCGGCGGCGGGGGCGGG - Intronic
962301854 3:134250515-134250537 GCGGCGGCAGCGCCAGGCGCGGG + Exonic
962682683 3:137816011-137816033 GCAGCAGGGGTGCCAGAGGCAGG - Intergenic
964720624 3:159764768-159764790 GCAGCGGCGGCGGCGGGGGCAGG + Exonic
964819712 3:160756060-160756082 GCGGCGCGGGCGGCAGGGACGGG + Intronic
968084267 3:195867533-195867555 GCCGTGGGGGCGGCGGGGGCTGG + Exonic
968088378 3:195884939-195884961 CCTGCTGGGCCCCCAGGGGCGGG + Exonic
968371224 3:198223734-198223756 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
968431121 4:559757-559779 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431125 4:559772-559794 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431139 4:559832-559854 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431146 4:559862-559884 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431153 4:559892-559914 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431174 4:559982-560004 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968456660 4:703974-703996 GGTGCTGGGGTGCAAGGGGCAGG - Intergenic
968512884 4:1003166-1003188 GCCGCGGAGGGGCGAGGGGCCGG + Intronic
968632509 4:1659325-1659347 GCTGCGGGGAGGCCCGGGGCTGG - Intronic
968898321 4:3418176-3418198 GCTCCCAGGGCGCCAGGGGGTGG + Intronic
968916340 4:3498571-3498593 GCTGAGGGAGCGCCGGGGCCTGG - Intronic
969816490 4:9691530-9691552 GCCGAGGCGGGGCCAGGGGCGGG - Intergenic
970267524 4:14305656-14305678 GCAACGGGGTTGCCAGGGGCTGG + Intergenic
970333015 4:15003728-15003750 GCGGCGGCGGCGGCGGGGGCGGG + Exonic
971231009 4:24800169-24800191 GCTCTGGGAGCGCCAGGCGCGGG + Exonic
971351939 4:25862995-25863017 GCTGCGGGGGCGGCGACGGCGGG - Intronic
972725856 4:41746063-41746085 GCTCCGGGGGCGGCGGGGCCCGG - Exonic
973285166 4:48407865-48407887 GATGAGTGGGTGCCAGGGGCTGG - Intronic
973759067 4:54100580-54100602 GCAGCGGGGGCGCAGGGGCCGGG + Exonic
976600711 4:86935284-86935306 GCGGCGGCGGCGTCGGGGGCCGG - Intronic
977810093 4:101347599-101347621 GCTGCAGGCGCGCAAGAGGCGGG - Intronic
978361105 4:107931793-107931815 GCTGCGGAGGCGCCGGGCGCGGG + Exonic
978578158 4:110206579-110206601 GCTGCTGGGGAGCCATGGTCAGG - Intergenic
978701767 4:111655370-111655392 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
979259910 4:118636207-118636229 GCTGCTGGGGCAACATGGGCAGG - Intergenic
979328474 4:119404418-119404440 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
980920901 4:139084416-139084438 GGGGCAGGGGCGGCAGGGGCAGG + Intronic
981044590 4:140253263-140253285 GCGGCGGCGGCGGCAGGGGTGGG + Intergenic
981475163 4:145180359-145180381 CCAGCGTGCGCGCCAGGGGCGGG - Intergenic
983181868 4:164657457-164657479 GCTGAGGAGGCCCCAGGGTCTGG - Intergenic
985103001 4:186476482-186476504 TCTGCGGGGGCTGCAGGGGATGG - Intronic
985115715 4:186588606-186588628 GCTGCTGGGAATCCAGGGGCGGG + Exonic
985666211 5:1182713-1182735 GCTGAAGGGGTGCCAGGGTCGGG + Intergenic
985788911 5:1915093-1915115 GATGCGGGGACCCCAGGGGGAGG - Intergenic
985995669 5:3595765-3595787 GCGGGAGGGGAGCCAGGGGCGGG + Intergenic
986082618 5:4410019-4410041 GCTGTGGTGGTGGCAGGGGCCGG + Intergenic
986325508 5:6670289-6670311 GCTGCAGGGAAGCCAGGGGGTGG + Intergenic
988777526 5:34490780-34490802 GGGGCGGGGGTGGCAGGGGCGGG + Intergenic
989613008 5:43313302-43313324 GCTGCGGAGGTGCCGCGGGCGGG - Intronic
990910074 5:60843985-60844007 GGTGCGGGGGCCCCGGGAGCGGG - Intronic
992056588 5:72996860-72996882 GCCACGGGGGCCCCCGGGGCCGG + Intronic
992910726 5:81393925-81393947 GCTGCGGGAGCGGCGGCGGCTGG - Intronic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995724602 5:115170010-115170032 GAGGCGGGGCCGCCTGGGGCTGG + Intronic
996900404 5:128537468-128537490 GTTGCGGCGGCGGCTGGGGCCGG + Exonic
997194004 5:131965608-131965630 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
997368717 5:133342302-133342324 GCTTAGAGGGCACCAGGGGCAGG + Intronic
997583936 5:135033895-135033917 GCGGCGGGCGCTCCAGGGGCCGG + Exonic
997597550 5:135117127-135117149 GCTGGGGTGGGGGCAGGGGCAGG + Intronic
997704114 5:135930641-135930663 GCTTCGGGGGCGGCCGGGCCCGG - Intronic
998097182 5:139402709-139402731 GCTGAGGGAGGGCCTGGGGCTGG + Intronic
998128014 5:139637423-139637445 GCGGCGGGGCCGGCAGGGGTGGG - Intergenic
998148266 5:139742793-139742815 GCTGCGGGGGAGCCGGGCTCAGG + Intergenic
998157635 5:139795709-139795731 ACTGCGGGCGCGCGAGCGGCGGG - Intergenic
999248272 5:150166978-150167000 ACTGCGGGGGCGCCGGGGGCGGG - Exonic
999399365 5:151252836-151252858 GCTGCGCGCGCGGGAGGGGCGGG - Intronic
999696347 5:154190999-154191021 GCGGCGGTGGCGCCGGCGGCGGG + Exonic
1001065109 5:168529674-168529696 TCGGCGGGGGCGGCCGGGGCCGG + Exonic
1001401977 5:171451222-171451244 GCGGGGGAGGCGCCGGGGGCCGG - Intronic
1002001730 5:176199924-176199946 GCTGCGGGGGAGCCTGAAGCTGG - Intergenic
1002106223 5:176880604-176880626 GCTGGGGGAGGGGCAGGGGCAGG - Exonic
1002186037 5:177455274-177455296 GCTGCGGCGGCGCCAGGCCCGGG - Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002419312 5:179137497-179137519 GCTGCGGGCTCGGCAGGGGCCGG - Intronic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002688922 5:181037116-181037138 CCTGGGTGGGAGCCAGGGGCAGG + Intergenic
1002691401 5:181053078-181053100 GCTGCGGTGGCGCCCGGAGAAGG + Intronic
1002898001 6:1390183-1390205 GCGGCGCGGGCGCCGGGAGCGGG + Exonic
1003049290 6:2765583-2765605 GCTGCGGCCGCGCCGGGCGCCGG + Exonic
1003162794 6:3650679-3650701 GCTGAGGTGGGTCCAGGGGCTGG - Intergenic
1003425755 6:5997236-5997258 GCTGCGGGGGCCCCGGGGGGGGG - Intergenic
1004241312 6:13924964-13924986 GCTGCGGCGGCGCCTGGGAGGGG - Exonic
1004262082 6:14117578-14117600 GCGGCGGGTGCGACGGGGGCGGG + Intronic
1004395846 6:15245820-15245842 GCTGCGGGGGTGCCCTGGACTGG + Intergenic
1005994751 6:30924386-30924408 CCTGAGGGGGCCCCAGGGGGCGG - Exonic
1006239498 6:32665099-32665121 GCTGCGGGGGCGGCCGGGCTGGG - Intronic
1006408814 6:33860239-33860261 CCTGCGGGGGCTCCAGGGTGGGG - Intergenic
1006740003 6:36301377-36301399 GCTGAGGAGGCGGCAGGGGCCGG - Intronic
1007767788 6:44171217-44171239 GCTGGGTGGGGTCCAGGGGCAGG - Intronic
1007784237 6:44270896-44270918 GCTGCGGCCGCGCCCGGGGAAGG - Intronic
1008932435 6:56954853-56954875 GGGGCGGGGGCGCCTGGGGAGGG - Intergenic
1011226616 6:85114986-85115008 GGGGCGGGGGCGCCGGGGGGTGG + Intergenic
1013022712 6:106235101-106235123 GCTGAGGAGGCCCCAGGGTCTGG - Intronic
1013422535 6:109979230-109979252 GCTGCGGCGGCTCTAGGAGCCGG + Exonic
1013514655 6:110875023-110875045 GCAGCGGCGGCGGCAGCGGCGGG + Exonic
1014459806 6:121682911-121682933 GCTGCGGTGGCACCATGAGCGGG + Intergenic
1014811673 6:125893596-125893618 GCTGTGGGGGGGCCAGAGGGTGG + Intronic
1014925645 6:127267074-127267096 GCGGCGGCGGGGTCAGGGGCCGG + Intronic
1015791555 6:136968942-136968964 GATGAGGAGGCGCCAGGGGACGG + Intergenic
1016010770 6:139135556-139135578 GCGGCGGGCGCGCCGGGCGCCGG + Exonic
1016086424 6:139920634-139920656 AAGGCGGGGGCGGCAGGGGCAGG + Intergenic
1016648197 6:146434409-146434431 GCTGCGGAGGTGGCGGGGGCGGG - Exonic
1018036594 6:159887469-159887491 GCTGGGGGGGCCCTGGGGGCTGG + Intergenic
1018247810 6:161839278-161839300 GCTGAGGGAGCGCCTGGAGCTGG + Intronic
1018400190 6:163414245-163414267 GCTGCGGGCGCGGTCGGGGCTGG - Intronic
1019058739 6:169241068-169241090 GCAGGGAGGGCGGCAGGGGCAGG - Intronic
1019232985 6:170584434-170584456 GCTGCCGGGGCCCCAGGCCCTGG - Exonic
1019233074 6:170584764-170584786 GAGGCAGAGGCGCCAGGGGCGGG - Intergenic
1019395719 7:816722-816744 GCTGCGGGGACGCGAGGCGGGGG + Intronic
1019501536 7:1367220-1367242 GATGTGGGGGCCCCGGGGGCAGG - Intergenic
1019530080 7:1498953-1498975 GGTGCGGGGGCGCCCCGGGGGGG - Exonic
1019697153 7:2452244-2452266 GCTGAGGTGGCCCCAAGGGCAGG + Intergenic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1019777111 7:2918451-2918473 CCTGTGGGGGCAGCAGGGGCAGG - Intronic
1019989552 7:4682248-4682270 GCAGCGGCGGCGCGGGGGGCGGG - Intergenic
1020086317 7:5312697-5312719 GCGGAGGAGGCGCCTGGGGCTGG + Exonic
1020178101 7:5898803-5898825 GCTGCAGCGGCGGCCGGGGCCGG + Exonic
1020274295 7:6615503-6615525 GCGGCGGCGGCGGCGGGGGCCGG + Intergenic
1020278294 7:6637477-6637499 GCGGCGCGGGCGGCAGGTGCGGG + Intronic
1020304826 7:6826172-6826194 GCTGCAGCGGCGGCCGGGGCCGG - Exonic
1020746894 7:12090487-12090509 ACTCCGGGGGCGCCATAGGCAGG - Intergenic
1021827944 7:24573369-24573391 GCGGCGGGGGCGACCGGAGCTGG + Exonic
1022114666 7:27251610-27251632 GCTGCGGTGGCGACTCGGGCCGG + Intergenic
1022207784 7:28180294-28180316 GATGCGGGGGCGCGAGGTGCCGG - Intronic
1022400184 7:30028820-30028842 GCCGGGGGCGCGCCGGGGGCCGG + Intronic
1023842232 7:44104224-44104246 GCTGCGGGGGGGCGGGGGGCGGG - Intergenic
1024018263 7:45338842-45338864 GCGGCGGGGGGGCAAGGGGAGGG + Intergenic
1024490521 7:49976988-49977010 GCTGCTCGGGCGCCTGAGGCAGG + Intronic
1024580001 7:50793507-50793529 GCGGCGGCGGCGGCAGAGGCGGG - Intergenic
1024647990 7:51384844-51384866 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025069692 7:55887628-55887650 GCGGCGGCGGCGTCAGGGGGCGG + Intronic
1025177183 7:56807889-56807911 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025207990 7:57004375-57004397 GCGGAGGAGGCGCCTGGGGCTGG - Intergenic
1025663961 7:63572500-63572522 GCGGAGGAGGCGCCTGGGGCTGG + Intergenic
1025694609 7:63768497-63768519 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026231624 7:68488848-68488870 GCTGCAGGGCTGCCAAGGGCTGG + Intergenic
1026564898 7:71481686-71481708 CCTGGAGGGGCTCCAGGGGCAGG - Intronic
1026822280 7:73557583-73557605 GCGGCGGGAGCGGCGGGGGCCGG + Exonic
1026845828 7:73698762-73698784 GGTGCCGGGGCCCGAGGGGCTGG + Intronic
1027390347 7:77697103-77697125 GCCCCGTGGGCGCCAGGGGGCGG - Intronic
1028378680 7:90175054-90175076 GCTGCTTGGGAGCCAGAGGCAGG - Intronic
1028985577 7:97006206-97006228 GCGGCGGCGGCGGCAGCGGCCGG + Exonic
1029080757 7:97972229-97972251 GCTGCAGCGGCGGCCGGGGCTGG - Intergenic
1029257796 7:99281070-99281092 GCTGAGGGGGCGGCAGGGCCAGG - Intergenic
1029374945 7:100171733-100171755 GGGGCGGGGGGGCCCGGGGCCGG - Intronic
1029449659 7:100633627-100633649 GACGTGGGGTCGCCAGGGGCAGG + Intronic
1029537001 7:101162958-101162980 GCGGCGGGGGCGCGCGGGGGCGG + Exonic
1029730130 7:102433493-102433515 GCTGCGGCGGCCGCGGGGGCGGG + Intronic
1030138767 7:106284741-106284763 GGGGCGGGGGCGGCTGGGGCTGG - Intronic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1032052134 7:128656200-128656222 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1032075469 7:128833848-128833870 GCTGCAGTGGAGCCAGGGGAAGG + Intronic
1032463189 7:132126747-132126769 GCTGCGGGTGCACAAGGGGTAGG + Exonic
1033145843 7:138869469-138869491 GCTGCGGGGGGCACAGGAGCAGG - Intronic
1033877596 7:145842068-145842090 GCTGCCTGGGAGCCAGGGCCTGG + Intergenic
1034271241 7:149804279-149804301 ACTGCCTGGGCGCCAGGAGCAGG + Intergenic
1034425194 7:151010335-151010357 GCTGGGGGGACCCCAGTGGCAGG + Intronic
1034994509 7:155569705-155569727 CCTGTGTGGGCACCAGGGGCTGG - Intergenic
1035021921 7:155805300-155805322 GGAGCGGGGGCGGCAGGGGCGGG - Intronic
1035026974 7:155832613-155832635 CCTGCGGGGAGGCAAGGGGCAGG - Intergenic
1035050171 7:155994182-155994204 GCTGAGGGAGAGCCAGGGCCAGG - Intergenic
1035240786 7:157527872-157527894 GCTGCGGGGGCTCCCAGGTCGGG + Intergenic
1035717205 8:1763659-1763681 GCGGCGGGCGCGGGAGGGGCGGG - Intronic
1035751933 8:2002383-2002405 GCTGCGAGCGCGCCTGGCGCAGG - Exonic
1036888715 8:12580543-12580565 GCTGCGGGGGAGGCTGAGGCAGG - Intergenic
1037336972 8:17801265-17801287 CCTCCGGGGCCGCCAGGGGGTGG + Intergenic
1037769355 8:21789603-21789625 GGTTCGGGGGCGCGCGGGGCCGG - Intronic
1037816844 8:22116952-22116974 GCTGCGGCGGCGCCTGCGGGAGG - Exonic
1038294010 8:26274439-26274461 GCTGCTTGGGCGGCTGGGGCAGG - Intergenic
1038295999 8:26291541-26291563 GCGGCGGCAGCGGCAGGGGCAGG - Intronic
1038304159 8:26383618-26383640 GCGGCGGGGACGCCGGGGGATGG + Intronic
1038449952 8:27633674-27633696 GCTGCGGGGGCGCACGGGCGAGG + Intergenic
1038484199 8:27922009-27922031 GCTGTGGGGGCTGCAGGCGCAGG - Exonic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1039979188 8:42392041-42392063 GCTACCGGGGCGCGGGGGGCCGG + Intronic
1040386426 8:46917833-46917855 GCAGGGGGCGCGCCAGGCGCGGG + Intergenic
1041292469 8:56320188-56320210 GCCGCGGCAGCGCCAGGGGTGGG + Exonic
1041355300 8:56993636-56993658 GCTGCGGCGGCGGCGGCGGCGGG - Exonic
1041698563 8:60762989-60763011 GGTGGGGGGGCGGCAGGGGGAGG + Intronic
1042040078 8:64580919-64580941 GAGGCGGCGGCGCCAGGGACAGG - Exonic
1042155730 8:65842136-65842158 GCTGCGGCGGCGCGGGGCGCTGG - Intronic
1044542268 8:93421070-93421092 GCTGCGTGGGAGCCAAGTGCAGG + Intergenic
1044569393 8:93700522-93700544 GCCGCGGCGGCGCGAGGGGCGGG + Exonic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045510024 8:102806730-102806752 GCTGGGTGGGCGCCCGCGGCAGG + Intergenic
1046103899 8:109644674-109644696 GCAGCGGCGGCGCGAGGAGCCGG - Exonic
1047245366 8:123138594-123138616 GCTTCGTGGCTGCCAGGGGCAGG - Intronic
1047934847 8:129766733-129766755 GTTGCGGTGGCGCCTGGGGGAGG - Intronic
1048990686 8:139758512-139758534 GCTGTGGGGAGGCCGGGGGCAGG + Intronic
1049109708 8:140635398-140635420 CCGGCGCGGGCGGCAGGGGCCGG - Intronic
1049354851 8:142182530-142182552 GCTGTGGGGCAGGCAGGGGCAGG + Intergenic
1049359189 8:142203891-142203913 GCAGGGGCGGGGCCAGGGGCGGG + Intergenic
1049367971 8:142249867-142249889 GCTGCGAGGCCACCATGGGCCGG - Intronic
1049387089 8:142348526-142348548 GCTTCGGGGCAGCCTGGGGCGGG - Intronic
1049433030 8:142574064-142574086 GCTGCCTGGGCGCCTGGGGAGGG - Intergenic
1049571137 8:143370798-143370820 GCTGCAGGGGCTCCCGGGGGAGG + Intronic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1049664197 8:143835770-143835792 GCGGAGGGGGCGCACGGGGCAGG - Intronic
1049757731 8:144318239-144318261 GGTGAGGGGCTGCCAGGGGCTGG - Exonic
1050143489 9:2541055-2541077 ACTCCAGGGGCGTCAGGGGCAGG + Intergenic
1052494680 9:29212306-29212328 GGTGTGGGGGCGCCAGGAGGCGG - Intergenic
1052903829 9:33817310-33817332 TCTTCGGGGGCCGCAGGGGCCGG - Intergenic
1052974455 9:34400918-34400940 GGGGCGGGGCCGCCAAGGGCCGG - Exonic
1053304082 9:36971717-36971739 GCTTCAGGGGAGCAAGGGGCAGG + Intronic
1053381195 9:37650848-37650870 GCTGCGCGGCCGCCAGCTGCCGG - Intronic
1054762314 9:69014094-69014116 GCGGTGGCGGCGGCAGGGGCGGG + Exonic
1056153937 9:83817193-83817215 GGAGCGCGGGCGCCAGCGGCGGG + Intronic
1056604608 9:88076503-88076525 GCTGCAGGGGCTCGAGGGGCTGG - Intergenic
1056773916 9:89497985-89498007 GCGGCGGCGGCGGCAGCGGCGGG + Intronic
1057600130 9:96450460-96450482 GCGGCGGCGGCGGCCGGGGCCGG + Exonic
1057619133 9:96619492-96619514 GCTGCGGGGACGGCGGGCGCCGG + Exonic
1057708111 9:97412258-97412280 GCTCCGGGCGCGACAGGTGCCGG + Intronic
1058508926 9:105694902-105694924 GTTGGAGGGGCGCCAAGGGCCGG + Intronic
1058908189 9:109498160-109498182 GGTGCGGGGCTGCCGGGGGCCGG - Intronic
1059197031 9:112380046-112380068 GCATCGGGGGGGGCAGGGGCGGG + Exonic
1059208451 9:112487384-112487406 GCGGCGGGGCGGCCCGGGGCAGG - Intronic
1059747204 9:117214577-117214599 GCTGCTGGGTCCCCAGGCGCGGG - Exonic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1060283493 9:122228886-122228908 GCTGCGCGCGGGCCGGGGGCGGG - Intronic
1060849199 9:126860691-126860713 GCGGAGGGGGCGCCGCGGGCGGG + Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061084781 9:128392588-128392610 GGGGCGGGGGCCCCAGGGACAGG - Intergenic
1061084787 9:128392603-128392625 GCTCCGGGCGCAACAGGGGCGGG - Intergenic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1061792125 9:133064382-133064404 GCTGCGAGGGAGACACGGGCAGG - Exonic
1062272232 9:135714802-135714824 GCTGCGGGGGCGCGCGGGACCGG - Intronic
1062393375 9:136342801-136342823 GCGGAGGGGGCGCCAGGGCTGGG + Intronic
1062400442 9:136370353-136370375 GCTGCGGGACCACCAGGAGCAGG - Exonic
1062426440 9:136508290-136508312 GCTGCGAGTGCCCCAGCGGCTGG - Exonic
1062444502 9:136587967-136587989 GTTGCGGGGGAGGCGGGGGCGGG + Intergenic
1062454739 9:136630128-136630150 GCTGAGGGGCAGCCTGGGGCTGG - Intergenic
1062472452 9:136712481-136712503 GCGGCGGGGGCGCGCGGGGGAGG - Intergenic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1062754873 9:138281790-138281812 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203468400 Un_GL000220v1:106303-106325 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1203476221 Un_GL000220v1:150275-150297 GAGGAGGGGGCGCCGGGGGCGGG - Intergenic
1203578781 Un_KI270745v1:25959-25981 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1185461156 X:333315-333337 ACTGCGGGGGCTCCAGGTGGTGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1186660832 X:11665805-11665827 GCTGGGGCGGAGCCAGGAGCAGG + Intergenic
1187403831 X:18984710-18984732 GCGGAGGTGGGGCCAGGGGCGGG - Intergenic
1188898196 X:35695627-35695649 GCTACTGGGGAGGCAGGGGCAGG + Intergenic
1189332370 X:40151938-40151960 GCGCTGGAGGCGCCAGGGGCCGG + Intronic
1190061683 X:47215685-47215707 GCTGGGGCGGCGGCAGGGCCGGG - Intergenic
1190216561 X:48482749-48482771 ACTGAGGGGCGGCCAGGGGCTGG - Exonic
1190298603 X:49043089-49043111 GGTGCGGGGCCGCCTGGGGCTGG - Exonic
1190339585 X:49286200-49286222 GCTGCGGGTGGGGCAGGGGGTGG + Exonic
1190712926 X:53082570-53082592 GCGGCGGCGGCGGCGGGGGCGGG - Exonic
1190822844 X:53990431-53990453 GCTGGGGGTGGGGCAGGGGCAGG + Intronic
1192251417 X:69417003-69417025 GGGGCGGGGGCGGCAGGGGGAGG - Intergenic
1192584095 X:72306550-72306572 GCGGCGTGCGTGCCAGGGGCTGG - Intronic
1195954882 X:110318157-110318179 GCCGGGGGCGCGCCAGAGGCTGG + Exonic
1196804092 X:119569386-119569408 GCTGGGGGGGCGGAGGGGGCAGG + Intergenic
1197774570 X:130110816-130110838 GCGGCAGGGGCGCCCGGGGAGGG + Intergenic
1198312608 X:135436553-135436575 GCTGCAGGGCCGCCTGGTGCTGG + Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1198766029 X:140080116-140080138 GCTGAGGAGGCCCCAGGGTCCGG - Intergenic
1199250835 X:145659865-145659887 GCTGCAGTGGTGCAAGGGGCGGG - Intergenic
1199967351 X:152831187-152831209 GCTACGGGGTCGCCCGGGTCGGG + Intronic
1200003189 X:153072520-153072542 GCTGCGGCGGCGGCGGGGTCGGG - Exonic
1200004534 X:153077489-153077511 GCTGCGGCGGCGGCGGGGTCGGG + Intergenic
1200077593 X:153559207-153559229 GATGAGTGGGTGCCAGGGGCTGG - Intronic
1200084907 X:153599231-153599253 GCGGCGGGGCGGCGAGGGGCGGG - Intronic
1200097193 X:153669893-153669915 GGGGCGGGGGGGGCAGGGGCGGG + Intronic
1200109845 X:153734936-153734958 GATGAGTGGGTGCCAGGGGCTGG - Intronic
1200155441 X:153972427-153972449 GCCGCGGGGGAGCCGGGGGCGGG + Exonic
1201262721 Y:12176198-12176220 GCTACGGGGGAGGCAGAGGCAGG + Intergenic
1201291035 Y:12421072-12421094 GCTGCGGGAGCGCGCGGGGAGGG - Intergenic
1201416241 Y:13751764-13751786 GATGCGAGGGCGCCGGGCGCTGG - Intergenic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic