ID: 1061609987

View in Genome Browser
Species Human (GRCh38)
Location 9:131739841-131739863
Sequence CCGGGCCGCCGCGGGGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061609969_1061609987 21 Left 1061609969 9:131739797-131739819 CCGGGCTGCGCCGGAGGCCGAGG 0: 1
1: 0
2: 9
3: 723
4: 20510
Right 1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG 0: 1
1: 0
2: 6
3: 21
4: 221
1061609977_1061609987 -2 Left 1061609977 9:131739820-131739842 CCGCCGCTCATCGGGCCCGGGCC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG 0: 1
1: 0
2: 6
3: 21
4: 221
1061609971_1061609987 11 Left 1061609971 9:131739807-131739829 CCGGAGGCCGAGGCCGCCGCTCA 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG 0: 1
1: 0
2: 6
3: 21
4: 221
1061609974_1061609987 4 Left 1061609974 9:131739814-131739836 CCGAGGCCGCCGCTCATCGGGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG 0: 1
1: 0
2: 6
3: 21
4: 221
1061609979_1061609987 -5 Left 1061609979 9:131739823-131739845 CCGCTCATCGGGCCCGGGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG 0: 1
1: 0
2: 6
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061609987 Original CRISPR CCGGGCCGCCGCGGGGCGAC AGG Intronic
900269164 1:1778400-1778422 CCGGGCGGCCATGGGGCAACAGG - Intronic
900284156 1:1891264-1891286 CCGGGCCGCCGGGGGTCTCCCGG - Intergenic
900632542 1:3644369-3644391 CCGGGGCTCAGCGGGGCCACTGG - Intronic
901198554 1:7453871-7453893 CCGGGCTGCTGCGGGGGGCCGGG - Intronic
901303642 1:8217244-8217266 CCGAGCCGTCCCGGGGCGACAGG + Intergenic
902769602 1:18637876-18637898 CCGGCCTGCCGAGGGGCCACGGG + Intronic
903142230 1:21345552-21345574 CGGGGCCGCCGCGGGGCCAATGG + Intergenic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
906525224 1:46489774-46489796 CCGGGCCCGCGCCGGGCGCCCGG + Intergenic
906615840 1:47232256-47232278 CCGGGCGGGCGCGGGGCGGGCGG - Intergenic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
908780397 1:67685342-67685364 CCGGGCGGGCGAGGGGCGGCCGG + Exonic
910251466 1:85201803-85201825 CCGGGCCGCGACGGGGCGCGCGG + Intergenic
912381366 1:109249770-109249792 CAGGGGCGCCGCGGGGCCCCCGG + Intergenic
915616889 1:157045937-157045959 CCCGGCCGCCGCGGCGTGAGGGG - Intergenic
916694391 1:167221307-167221329 CGGGTCCGCGGCGGGGCGGCGGG + Intronic
921046126 1:211479173-211479195 CCAGGCTGCCGCGGGGCCGCAGG + Exonic
922730700 1:227947673-227947695 CCGGGGCGCGGCGGGGCCGCCGG - Intronic
922739386 1:228006918-228006940 CCGGGGCGGCGCGGGGCGGCGGG - Intergenic
923107796 1:230868122-230868144 CCGGGGCGCCTCGGGGCGCCGGG + Intronic
924527139 1:244863275-244863297 CGGCGCCACCGCGGGCCGACCGG + Intronic
1063929959 10:11018461-11018483 CCGGGTCCCCGCGGGGTGAGTGG + Intronic
1064011980 10:11742678-11742700 CCCGGCCGGGGCGGGGCGGCGGG + Exonic
1064354243 10:14603840-14603862 GCCGGGCGCCGCGGGGCGAGGGG + Intronic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1066994750 10:42553207-42553229 CCGCGGCGCAGCGGGGCCACAGG - Intergenic
1069424724 10:68279148-68279170 CCGGACCGCCGCGGGGCCATGGG + Intergenic
1073063170 10:100744196-100744218 CCGCGCTTCCGCGGGGCGCCCGG + Intronic
1073217286 10:101843573-101843595 CCGGGCGGGAGCGGGGCGCCGGG - Intronic
1073875283 10:107914996-107915018 TCGGGCCGCGGCGGGGCGGGTGG + Intergenic
1074377379 10:112951285-112951307 CCGGGCGGCTGCGGGGCGCGCGG - Intronic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1076035399 10:127195740-127195762 CCGGGTCGCTGAGGGGCGTCTGG - Intronic
1076395777 10:130136569-130136591 CCGGGCCGGTGTGGGGCGGCGGG + Intronic
1078345099 11:10541001-10541023 CCAGGCTTCCGCGGGGAGACAGG - Intronic
1080551399 11:33376378-33376400 TCGCGCCGGCGCGCGGCGACAGG + Intergenic
1081528429 11:43942620-43942642 CCTGGCCGCCGCGGGGCAGACGG + Exonic
1083335149 11:61917666-61917688 CCGGCCCGCCGCGCCGGGACAGG + Intronic
1083682783 11:64359036-64359058 CCGGGCTGCCGGTGGGCGGCCGG - Intergenic
1083885636 11:65572307-65572329 GCGGGGCGCGGCGGGGAGACGGG + Intronic
1083997230 11:66278431-66278453 CCGGGCCGCCGCCCGGCGCGGGG + Exonic
1084028401 11:66466945-66466967 CCGGGCCGCTGCGGCGGGATGGG - Exonic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1084972998 11:72781603-72781625 CCGGGCGGGCGCGGGGCGGGTGG + Intronic
1085311709 11:75520806-75520828 CCGGGCCACAGCGGGGTCACTGG - Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1089347063 11:117797289-117797311 CCGGGGTGCCGCGGGGGGGCGGG - Intronic
1091616124 12:2052689-2052711 CCCGGCCGCCGGCGGGCGAGGGG - Intronic
1091740767 12:2959261-2959283 CCGGGCCGCCGGGGCGGGGCGGG - Intergenic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096465852 12:51847590-51847612 CCGGGCCGCCGCTGGGCGCAGGG + Intergenic
1097787789 12:63780070-63780092 CCGGGTCCCCGCGGGGCCTCAGG + Exonic
1097938575 12:65279168-65279190 CTGGGCCCGCGCGGGGCGAGAGG - Intronic
1098991183 12:77065852-77065874 GCGGGGCGGCGCGGGGCGGCGGG + Intergenic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1103363667 12:120368343-120368365 CCGGGCCGCTCCGGGGTCACCGG - Intronic
1103521328 12:121538169-121538191 GAGGGAGGCCGCGGGGCGACCGG + Intronic
1103698688 12:122836053-122836075 CGGGGCCGGCGCGGCCCGACTGG + Intronic
1104929257 12:132329484-132329506 CGGGGGCGCCGGGGGGCGGCGGG + Intergenic
1106087640 13:26557746-26557768 CCGGGCGGCCGCGGCGCGGCGGG + Exonic
1106683378 13:32031323-32031345 CACGGCCGCCGCGGGGCTAAGGG - Exonic
1111935024 13:94549350-94549372 CCGGGCCGCGGTGGCGAGACGGG - Intergenic
1112494806 13:99896163-99896185 CCCGCCCGCCGCGGGCCGCCCGG + Exonic
1112520361 13:100089274-100089296 CCGTGCCGCCTCTGGGCGGCTGG + Intronic
1113656843 13:112072835-112072857 CCGGGCCTCCTCGGGGCCTCGGG + Intergenic
1113994167 14:16053173-16053195 CGGGCCCGACGAGGGGCGACTGG + Intergenic
1115993793 14:39175206-39175228 CCGCGCCGCCGAGGCGCGAAAGG - Exonic
1118186472 14:63542892-63542914 CCGGGCAGCTGCGGGGAGCCTGG + Exonic
1119325864 14:73759384-73759406 CCGAGCCGCCGCGGGCCGCCGGG + Intronic
1119743255 14:77027562-77027584 CCGGGCCGCCGCCGCCCGTCGGG - Exonic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122230943 14:100306155-100306177 CCGGGCCGGGGCGAGGCGTCCGG - Intronic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1124132842 15:27004971-27004993 CTGGGCCTCAGCGGGGTGACTGG + Intronic
1125603058 15:40926003-40926025 CCGGCCCGCCGCGTGCCAACTGG - Intergenic
1127606486 15:60592358-60592380 CCCGGCCCCGGCGGGGCGCCCGG + Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128865989 15:71115562-71115584 CAGGGCGGGCGCGGGGCGGCTGG + Intronic
1130991597 15:88879054-88879076 CCGGGCCACCGCAGGGCTGCCGG + Exonic
1131119792 15:89814965-89814987 CCGGGAAGCCGCGGGCGGACGGG - Intronic
1131825838 15:96322186-96322208 GCGGGCCGCCGCGGGGCCGAGGG - Intergenic
1132683422 16:1152938-1152960 GCGGGGCGCCGGGCGGCGACAGG + Intergenic
1132719811 16:1309987-1310009 CCGGGCCGCCGCAGGCCTTCGGG + Intronic
1132977788 16:2719286-2719308 CCGGGCCACTGAGGGGCCACTGG + Intronic
1134081420 16:11327513-11327535 CCTGGCCGCCGCGTGGAGACTGG - Intronic
1134134115 16:11668496-11668518 CGGGGCTGCTGCGGGGCGATCGG + Exonic
1137056618 16:35749246-35749268 CCGGGCCGCGGTGGGGGCACAGG - Intergenic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1138591155 16:58000418-58000440 CAGGGCAGGCGCGGGGCGAGCGG + Intronic
1139386940 16:66578975-66578997 GCGGGCCTCTGCGGGGCGTCGGG - Exonic
1139534531 16:67563061-67563083 GCGGGCCGCGGCCGGGCGATCGG - Intronic
1141054751 16:80804562-80804584 CCGGGCCGGCGGCGGGCGCCGGG - Intergenic
1141054837 16:80804749-80804771 CGGGGCCCCCGGGGGGCGGCGGG + Intergenic
1143590840 17:7885213-7885235 CCGGACCGCCGCGGGGCCACGGG - Intronic
1144695885 17:17303605-17303627 GCGGGGCGGCGCGGGGCGGCGGG + Exonic
1146208307 17:30922772-30922794 ACCGGCCGCTGCGCGGCGACCGG - Intronic
1147110257 17:38256766-38256788 CTGGGCGGCCGCAGGGCGCCGGG - Intergenic
1147757891 17:42780541-42780563 GCGGGCCGCGGGGCGGCGACGGG + Intergenic
1148332035 17:46818921-46818943 CCCGGACGCCGCGGGGCTTCGGG + Intronic
1148388631 17:47254196-47254218 CCCGGCCGCCGCGGCGCGCACGG + Intronic
1148419255 17:47531665-47531687 CTGGGCGGCCGCAGGGCGCCGGG + Intronic
1149614799 17:57988415-57988437 CAGGGCCCCCGCGGGGGGGCTGG + Intergenic
1150108557 17:62479014-62479036 CCGGGCGGCCGCGGGGGGCGCGG - Exonic
1151224875 17:72640589-72640611 CTGGGCCTCCCCGGGGCGCCGGG - Intergenic
1151954307 17:77373049-77373071 TCTGGCCGCAGCGGGGCGCCCGG + Intronic
1152356514 17:79810171-79810193 CGGGGCCGCGGCCGGGCGAGCGG + Intergenic
1152357250 17:79813287-79813309 GGGGGCGGCCGCGGGGCGAGCGG - Intergenic
1153688396 18:7567926-7567948 GCGGGCCGGCGCGGGACGCCCGG + Intronic
1154215128 18:12410200-12410222 CCGGGCCCCGGCGGGGTGCCAGG - Intronic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1156099740 18:33578732-33578754 GCGGACCGGCGCGGGGCGAGCGG - Intronic
1156461152 18:37322046-37322068 CCGTGCCGTCGAGGGGAGACGGG - Intronic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160719361 19:590596-590618 CCGGGCCCCCTCGCGCCGACCGG - Intronic
1160793951 19:935248-935270 CCAGGCCGCGGCGGGGGGCCGGG + Intronic
1160872949 19:1285491-1285513 CCCGGCCCCCGCAGGGAGACTGG + Intergenic
1160873663 19:1287662-1287684 CCGGGCCGCTGGGGGACGGCTGG + Intronic
1161068992 19:2251192-2251214 CCGGGCCTCCGCGCCGCGCCTGG + Exonic
1161327562 19:3670957-3670979 CTGGGCCGCGGCGGGGCGGAAGG + Intronic
1161333846 19:3700486-3700508 CCGGGCCGGCGCGGGGCGGACGG + Intergenic
1161435061 19:4258220-4258242 CCTGGCGGGCGCGGGGCGGCGGG - Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162312051 19:9913665-9913687 CTGGCCCGCCGCGGGGCGCTCGG + Intronic
1162486081 19:10961237-10961259 CCGGGGCGCCGAGGGGGGAGGGG + Intronic
1162925295 19:13927907-13927929 CCGGCCCACAGGGGGGCGACTGG + Exonic
1162951779 19:14075241-14075263 CCGGGCCGCCAGGGGGCGGTAGG - Intergenic
1163608234 19:18287461-18287483 CCCGGCGGCTGCGGGGCGTCAGG - Intergenic
1163701883 19:18790221-18790243 TCGGGCCGCCCCGGGGCGGGGGG - Intronic
1163782703 19:19258640-19258662 CCAGGCCGCCGCAGGGCTCCCGG + Exonic
1165349482 19:35268403-35268425 CCGGGGCTCCGCGGGGCGCGAGG - Intergenic
1167251113 19:48398868-48398890 CCGGGGCGGGGCGGGGCCACAGG + Intronic
1167293230 19:48635715-48635737 ACGGGCCACCGGGGGGCGGCGGG + Exonic
1167709075 19:51099071-51099093 ACGGGGCGACGCGGGGCGGCTGG - Exonic
925029197 2:636471-636493 CCGGCCCACCCCGGGGAGACAGG + Intergenic
925609439 2:5691788-5691810 CAGGGCCGCCGCGGGGCTACCGG + Intergenic
926101640 2:10122233-10122255 CCGGGCCGCCGCCGGGCAGGGGG - Intergenic
927472401 2:23385838-23385860 CCTGGCCGCCGCGTGGGGCCGGG + Intronic
927714317 2:25342177-25342199 CCGGGGCGCCGCGGCGGGAGCGG + Intronic
927881505 2:26692845-26692867 CCGGGCCGCCGCCGGCCCCCCGG - Exonic
927956712 2:27212113-27212135 CCGGGAAGCCGCGCGGCGACGGG + Exonic
927997339 2:27495211-27495233 CCGGGCTGCGGCGGAGCGAGCGG - Exonic
930096526 2:47570542-47570564 CCGGGCACCCGCTGGGCCACGGG - Exonic
931614643 2:64144020-64144042 CGGGGCCGCCGAGGGGCGCGGGG - Intronic
932699992 2:73985454-73985476 CCGCGCCGCCGAGGGGCGCGGGG - Intergenic
933876294 2:86623939-86623961 TCGGGGAGCCGCGGGGCTACCGG + Intronic
934754451 2:96816015-96816037 CCGGGAGGACGCGGGGCGGCGGG - Intergenic
934754528 2:96816217-96816239 CCGGGGAGGCGCGGGGCGAGCGG + Intergenic
935622860 2:105144191-105144213 CCGGGCCGCGGGGGGTCGGCGGG + Intergenic
935645329 2:105329669-105329691 GCGGGCCGGAGCGGGGCGGCGGG - Exonic
936396953 2:112138531-112138553 CCGCGCGGCCGGGGGGCGGCTGG - Exonic
937221497 2:120345294-120345316 CCGGCCGGGCGCGGGGCGCCGGG - Intergenic
938537487 2:132257697-132257719 CGGGCCCGACGAGGGGCGACTGG - Intronic
946313851 2:218897172-218897194 CCGGGCCGCTGCGGTGCGCGGGG + Intronic
947636012 2:231681083-231681105 CCGGGCCGCCGCTGGGGGCTCGG + Intergenic
947636076 2:231681269-231681291 CAGGGCCGGAGCGGGGCGCCCGG - Intergenic
947641709 2:231710691-231710713 CCTAGCCGCCGCGGGGAGGCCGG + Intronic
948116082 2:235494857-235494879 CCGGGCCGCCTTGGGGCCTCGGG + Intronic
948393341 2:237627580-237627602 CCGGGCCGGGGCGGCGCGAGCGG + Intronic
948724950 2:239928910-239928932 CCGGGTGGCCGCGGGGCGATGGG - Intronic
1168765806 20:381142-381164 CCGGGCCCACGCGGAACGACGGG + Exonic
1168804351 20:663679-663701 CCGGGCCGGCGGGGGTCGGCGGG + Exonic
1169558115 20:6770048-6770070 CCGGGCCGCGGGGGCGCGAGGGG + Intronic
1171866395 20:30489476-30489498 CGGGCCCGACGAGGGGCGACTGG - Intergenic
1172028962 20:31968285-31968307 CCGGGCCCCCGGGGGTCGTCGGG + Exonic
1174134931 20:48373040-48373062 CGGGTCCGCCGGGCGGCGACGGG - Intergenic
1174576863 20:51542898-51542920 CCGGGCCACCGCTGGGCGCTGGG + Intronic
1175399569 20:58692821-58692843 CCGGGCCGGAGCGGGGCGAAGGG + Exonic
1175399655 20:58693100-58693122 CGGGGCCTCCGCGGGCCGCCCGG - Intronic
1175428880 20:58889251-58889273 CCGGGCTGCGGCGCGGCGGCTGG + Intronic
1176111357 20:63412185-63412207 ACAGGCCGCGGCGGGGCAACGGG + Intronic
1178487330 21:33027417-33027439 CCAGGCCGCCGCAGGCCGACGGG - Exonic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180313102 22:11254342-11254364 CGGGCCCGACGAGGGGCGACTGG - Intergenic
1180744414 22:18077980-18078002 CCGGGACGCCGCGCGGCTGCGGG + Exonic
1181028903 22:20140697-20140719 CCGGGCCTCACCGGGGCGCCAGG - Exonic
1182260958 22:29072993-29073015 GCGGGCCGGGGCGGGGCGGCCGG + Intergenic
1183093738 22:35540441-35540463 CCGGGGCGAGGCGGGGCGCCGGG + Intergenic
1183788355 22:40045048-40045070 CCGGGACGGAGCGGGGCGGCCGG + Intronic
1183942036 22:41301463-41301485 CCCGGGCGCGGCGAGGCGACGGG + Intergenic
1184101592 22:42343988-42344010 GCGGGCGGCCGCGGCGCGCCGGG + Intergenic
1184557436 22:45240924-45240946 CCGGGCCGGGGCGGGGCGAGCGG - Intergenic
949105687 3:197739-197761 CCAGACCGCCGAGGGGCGAGAGG + Intronic
954113139 3:48446904-48446926 CCGGCCCGCCGCCGGGCACCGGG + Exonic
954401380 3:50321436-50321458 CCGGGCCGCGCCTGGGCGAACGG - Exonic
954795902 3:53161280-53161302 CCGGGCCTCCGCGCGGCGGGCGG - Exonic
956892335 3:73624842-73624864 CGGGGTCGCCGCCGGGCGGCCGG + Exonic
968653841 4:1770350-1770372 CCGGGCTGCCGCGGGGCCCAGGG - Intergenic
969344783 4:6563788-6563810 CCGGGCGGCTGCGGGGGGCCGGG + Intergenic
969694121 4:8725291-8725313 CCGGGCCGCCACAGGGCAGCTGG + Intergenic
975870691 4:78776094-78776116 CGGGGCGGCGGCGGCGCGACGGG + Intergenic
977908146 4:102501132-102501154 CGGGGCCGCTTCGGGGCGCCGGG - Intergenic
981315621 4:143337142-143337164 CCGGGCAGCTGAGGGGCGGCGGG - Exonic
984735020 4:183099863-183099885 CCGGGCCGACGCCGCGCGCCAGG + Intronic
985784465 5:1886709-1886731 GCGGGCCGGCGCGGGGCGGGGGG - Intronic
985896266 5:2751489-2751511 CCGGGGCGCGGCGCGGCGGCGGG + Exonic
985896359 5:2751797-2751819 CCGGGCCGCGGCCGGGGGAGGGG + Intergenic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
988825195 5:34929309-34929331 CGGGGCCTCGGCGGGGCGAGAGG - Intergenic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
997302012 5:132813433-132813455 CCGGGGCGTCTCGGGGCGAAGGG - Intergenic
1002368458 5:178730680-178730702 CCGGCGCGCCGCGGGGTGAGCGG - Exonic
1002524059 5:179806075-179806097 CCAGGCCGGCGCGGGGCAGCAGG + Intronic
1002645305 5:180649706-180649728 CCAGCCCGCCGCGGGGCGTCCGG + Intergenic
1002664068 5:180810138-180810160 CCGGGCCGCTGGGGGTCGAGGGG - Intronic
1006513849 6:34535391-34535413 CCAGGCCCCCGCAGGGCGAAGGG - Intergenic
1007072838 6:39049183-39049205 CAGGGCGGCCGCGGGGCAGCGGG - Intronic
1015220675 6:130801590-130801612 CCGGACCGCCGCGGGGCCACGGG + Intergenic
1016330065 6:142945844-142945866 CCCGGCCGCCGCCGGGTGACAGG + Intergenic
1016439012 6:144064547-144064569 CCGGGCGGCCGCTGGGCGTGCGG + Intronic
1017877533 6:158536877-158536899 GCGGGCAGCGGCGGGGCGGCCGG + Intronic
1021085969 7:16421293-16421315 CCGGGCCGCCGGGCAGCGCCAGG - Exonic
1022326585 7:29337608-29337630 CCAGGCTGCCACGGGGTGACAGG + Intronic
1022363354 7:29684996-29685018 CGGGGCCGCCGCGGCGCCGCCGG + Intergenic
1023638592 7:42237128-42237150 GCGGGCGGCCGCGGGGCGCGCGG + Intronic
1026017549 7:66682698-66682720 CCCGGCCGCGGCAGGGCGCCGGG + Intronic
1032068601 7:128790908-128790930 CCAGGCTGCCGAGGGGCCACCGG + Intronic
1032087276 7:128890845-128890867 CCGGGGCGGGGCGGGGCGGCAGG + Intronic
1032298830 7:130668472-130668494 CCGGGCAGCCGCGAGGGGAGGGG + Intronic
1033299714 7:140176028-140176050 CCGGGCCCCCGGCGGGCGGCAGG - Intronic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034942042 7:155237039-155237061 CCGGGCCACTGAGGGGCGAGGGG - Intergenic
1034977577 7:155457428-155457450 TCCGGCCGCCGCTGGGTGACAGG - Intergenic
1035612150 8:973811-973833 CCGGACCGCCGCGGGGCCACGGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1047739400 8:127794578-127794600 CCGGGCGGGCTCGGGGCGGCCGG + Intergenic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1053306187 9:36986254-36986276 CCTGGCCGCCGCGGGCCGCGCGG + Intronic
1055308192 9:74952204-74952226 CAGGACCCCCGCGGGGAGACTGG - Exonic
1056078243 9:83062897-83062919 CCGGAGCGCCGCGGGGCGCAGGG + Exonic
1057198454 9:93127851-93127873 CCGGGGTGCCGCAGGGCCACAGG + Intronic
1057207811 9:93184107-93184129 CCGGTCCGGGGCGGGGCGAACGG + Intergenic
1057259672 9:93576682-93576704 CCGGGCCGCGCGGGGGCGGCGGG - Exonic
1057716694 9:97501643-97501665 CCGGGCGGCCGCGGGCGGGCGGG - Exonic
1059191659 9:112333245-112333267 CCGGGGCGCCGCGTGGGGAAAGG + Intronic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1060355690 9:122905146-122905168 CCGCGCCGTCGCGGGGCTCCCGG - Intronic
1060700959 9:125748066-125748088 CGGGCCCGGCGCGGGGCGATGGG + Intronic
1061208211 9:129176456-129176478 CCTGGCCGCCGGGGCGCGCCGGG - Exonic
1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG + Intronic
1061807471 9:133144420-133144442 CGGGGCCGAGGCGGGGTGACTGG - Intronic
1061975793 9:134067591-134067613 CCGGGCTGGCGCGGGGCGCGCGG + Intronic
1061987091 9:134136175-134136197 CCGGGCCGCGGCGGCGGGGCCGG - Exonic
1062414069 9:136439193-136439215 GCGGGGGGCCGCGGGGCGATGGG + Exonic
1185469360 X:373502-373524 TCGGGCAGCCGCGGGGCGCGCGG + Intronic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1190024707 X:46912670-46912692 CCGGGCCGCGGCGTGGAGCCGGG + Exonic
1200128898 X:153830611-153830633 CCGGGCCGCCAGGGGCCGTCAGG + Intergenic