ID: 1061612714

View in Genome Browser
Species Human (GRCh38)
Location 9:131758755-131758777
Sequence CATGGAGCTCATGCTCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061612714_1061612721 11 Left 1061612714 9:131758755-131758777 CCAGACGGAGCATGAGCTCCATG No data
Right 1061612721 9:131758789-131758811 TGTTCTGGACCAGAAAGTTCTGG No data
1061612714_1061612720 -4 Left 1061612714 9:131758755-131758777 CCAGACGGAGCATGAGCTCCATG No data
Right 1061612720 9:131758774-131758796 CATGGTGGGGAGCTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061612714 Original CRISPR CATGGAGCTCATGCTCCGTC TGG (reversed) Intergenic
No off target data available for this crispr