ID: 1061615450

View in Genome Browser
Species Human (GRCh38)
Location 9:131775992-131776014
Sequence GAGGTTAGGTCTTGGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061615450_1061615457 13 Left 1061615450 9:131775992-131776014 CCACTTTCCCAAGACCTAACCTC No data
Right 1061615457 9:131776028-131776050 AGAGAGTGGAACTTGAACCCAGG No data
1061615450_1061615458 14 Left 1061615450 9:131775992-131776014 CCACTTTCCCAAGACCTAACCTC No data
Right 1061615458 9:131776029-131776051 GAGAGTGGAACTTGAACCCAGGG No data
1061615450_1061615456 -1 Left 1061615450 9:131775992-131776014 CCACTTTCCCAAGACCTAACCTC No data
Right 1061615456 9:131776014-131776036 CTGGTTAGCAAGAGAGAGAGTGG No data
1061615450_1061615459 18 Left 1061615450 9:131775992-131776014 CCACTTTCCCAAGACCTAACCTC No data
Right 1061615459 9:131776033-131776055 GTGGAACTTGAACCCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061615450 Original CRISPR GAGGTTAGGTCTTGGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr