ID: 1061616734

View in Genome Browser
Species Human (GRCh38)
Location 9:131785283-131785305
Sequence CAAGCTAATCCCTCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061616734_1061616750 16 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616750 9:131785322-131785344 GGGGGCAGAGGGGGCAGGGCTGG No data
1061616734_1061616747 7 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616747 9:131785313-131785335 CCTTTGACAGGGGGCAGAGGGGG No data
1061616734_1061616749 12 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG No data
1061616734_1061616743 4 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616743 9:131785310-131785332 AGGCCTTTGACAGGGGGCAGAGG No data
1061616734_1061616745 6 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616745 9:131785312-131785334 GCCTTTGACAGGGGGCAGAGGGG No data
1061616734_1061616751 17 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616751 9:131785323-131785345 GGGGCAGAGGGGGCAGGGCTGGG No data
1061616734_1061616744 5 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616744 9:131785311-131785333 GGCCTTTGACAGGGGGCAGAGGG No data
1061616734_1061616741 -3 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616741 9:131785303-131785325 TTGTCACAGGCCTTTGACAGGGG No data
1061616734_1061616739 -5 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616739 9:131785301-131785323 GCTTGTCACAGGCCTTTGACAGG No data
1061616734_1061616742 -2 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616742 9:131785304-131785326 TGTCACAGGCCTTTGACAGGGGG No data
1061616734_1061616748 11 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616748 9:131785317-131785339 TGACAGGGGGCAGAGGGGGCAGG No data
1061616734_1061616740 -4 Left 1061616734 9:131785283-131785305 CCCCTCCATGAGGGATTAGCTTG No data
Right 1061616740 9:131785302-131785324 CTTGTCACAGGCCTTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061616734 Original CRISPR CAAGCTAATCCCTCATGGAG GGG (reversed) Intergenic
No off target data available for this crispr