ID: 1061622493

View in Genome Browser
Species Human (GRCh38)
Location 9:131820227-131820249
Sequence AAACTGACCGATAGAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061622493_1061622498 19 Left 1061622493 9:131820227-131820249 CCCTCTGTTCTATCGGTCAGTTT No data
Right 1061622498 9:131820269-131820291 CCACACTGTCCTAATTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061622493 Original CRISPR AAACTGACCGATAGAACAGA GGG (reversed) Intergenic
No off target data available for this crispr