ID: 1061623001

View in Genome Browser
Species Human (GRCh38)
Location 9:131823922-131823944
Sequence CAGACAGCTCTTTCTGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061622990_1061623001 21 Left 1061622990 9:131823878-131823900 CCGTCAGCGCTCTGTCAGGGAGG No data
Right 1061623001 9:131823922-131823944 CAGACAGCTCTTTCTGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061623001 Original CRISPR CAGACAGCTCTTTCTGCGTG GGG Intergenic
No off target data available for this crispr