ID: 1061625952

View in Genome Browser
Species Human (GRCh38)
Location 9:131840762-131840784
Sequence GAGTTGTTCTGCGCCATCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061625952_1061625953 -5 Left 1061625952 9:131840762-131840784 CCAACGATGGCGCAGAACAACTC No data
Right 1061625953 9:131840780-131840802 AACTCTGTCCTTTTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061625952 Original CRISPR GAGTTGTTCTGCGCCATCGT TGG (reversed) Intergenic
No off target data available for this crispr