ID: 1061625953

View in Genome Browser
Species Human (GRCh38)
Location 9:131840780-131840802
Sequence AACTCTGTCCTTTTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061625950_1061625953 9 Left 1061625950 9:131840748-131840770 CCAACATCTTGGTACCAACGATG No data
Right 1061625953 9:131840780-131840802 AACTCTGTCCTTTTCTCCTTTGG No data
1061625952_1061625953 -5 Left 1061625952 9:131840762-131840784 CCAACGATGGCGCAGAACAACTC No data
Right 1061625953 9:131840780-131840802 AACTCTGTCCTTTTCTCCTTTGG No data
1061625948_1061625953 29 Left 1061625948 9:131840728-131840750 CCTGAGAGGGTCTCAGCAAACCA No data
Right 1061625953 9:131840780-131840802 AACTCTGTCCTTTTCTCCTTTGG No data
1061625947_1061625953 30 Left 1061625947 9:131840727-131840749 CCCTGAGAGGGTCTCAGCAAACC No data
Right 1061625953 9:131840780-131840802 AACTCTGTCCTTTTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061625953 Original CRISPR AACTCTGTCCTTTTCTCCTT TGG Intergenic
No off target data available for this crispr