ID: 1061626879

View in Genome Browser
Species Human (GRCh38)
Location 9:131845799-131845821
Sequence CTGCTTTTCTTGACTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061626877_1061626879 -10 Left 1061626877 9:131845786-131845808 CCCGCTCATTAAACTGCTTTTCT No data
Right 1061626879 9:131845799-131845821 CTGCTTTTCTTGACTAAAGATGG No data
1061626876_1061626879 13 Left 1061626876 9:131845763-131845785 CCTTTCTCTTCATGAGGCAGAAA No data
Right 1061626879 9:131845799-131845821 CTGCTTTTCTTGACTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061626879 Original CRISPR CTGCTTTTCTTGACTAAAGA TGG Intergenic
No off target data available for this crispr