ID: 1061627133

View in Genome Browser
Species Human (GRCh38)
Location 9:131847459-131847481
Sequence GGTTCAAGGCACCGTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627133_1061627144 17 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627133_1061627149 26 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627149 9:131847508-131847530 CACCCGGGGGTGGGTGGGGAGGG No data
1061627133_1061627140 11 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627140 9:131847493-131847515 TCTCTCTTCTGTCTACACCCGGG No data
1061627133_1061627148 25 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627148 9:131847507-131847529 ACACCCGGGGGTGGGTGGGGAGG No data
1061627133_1061627139 10 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data
1061627133_1061627141 12 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627141 9:131847494-131847516 CTCTCTTCTGTCTACACCCGGGG No data
1061627133_1061627147 22 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627147 9:131847504-131847526 TCTACACCCGGGGGTGGGTGGGG No data
1061627133_1061627146 21 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627133_1061627143 16 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627143 9:131847498-131847520 CTTCTGTCTACACCCGGGGGTGG No data
1061627133_1061627145 20 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627145 9:131847502-131847524 TGTCTACACCCGGGGGTGGGTGG No data
1061627133_1061627142 13 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627142 9:131847495-131847517 TCTCTTCTGTCTACACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627133 Original CRISPR GGTTCAAGGCACCGTGATTT GGG (reversed) Intergenic
No off target data available for this crispr