ID: 1061627137

View in Genome Browser
Species Human (GRCh38)
Location 9:131847473-131847495
Sequence AGAAGCCTCTGCCTGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 249}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627137_1061627145 6 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627145 9:131847502-131847524 TGTCTACACCCGGGGGTGGGTGG No data
1061627137_1061627143 2 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627143 9:131847498-131847520 CTTCTGTCTACACCCGGGGGTGG No data
1061627137_1061627140 -3 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627140 9:131847493-131847515 TCTCTCTTCTGTCTACACCCGGG No data
1061627137_1061627153 30 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG No data
1061627137_1061627139 -4 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data
1061627137_1061627146 7 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627137_1061627148 11 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627148 9:131847507-131847529 ACACCCGGGGGTGGGTGGGGAGG No data
1061627137_1061627152 22 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627152 9:131847518-131847540 TGGGTGGGGAGGGCTAGCTGAGG No data
1061627137_1061627144 3 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627137_1061627149 12 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627149 9:131847508-131847530 CACCCGGGGGTGGGTGGGGAGGG No data
1061627137_1061627142 -1 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627142 9:131847495-131847517 TCTCTTCTGTCTACACCCGGGGG No data
1061627137_1061627147 8 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627147 9:131847504-131847526 TCTACACCCGGGGGTGGGTGGGG No data
1061627137_1061627141 -2 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627141 9:131847494-131847516 CTCTCTTCTGTCTACACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627137 Original CRISPR AGAAGCCTCTGCCTGGTTCA AGG (reversed) Intergenic
900250120 1:1664551-1664573 AGAAGCCTCTGCCTAACACACGG + Exonic
900261152 1:1730457-1730479 AGAAGCCTCTGCCTAACACACGG + Intronic
900481906 1:2903472-2903494 AGAGTCCTCTGCCTGGGTCTGGG - Intergenic
900755272 1:4430189-4430211 AGGACCCACTTCCTGGTTCATGG - Intergenic
900968941 1:5978629-5978651 AGAAGCCTGTGTCTGTTCCAAGG - Intronic
901160837 1:7175723-7175745 AGAAGCCTCGGCCAGGGACAGGG - Intronic
901194327 1:7431997-7432019 GGTTGCCTCTGCCTGGCTCAGGG - Intronic
901316359 1:8312445-8312467 GGCTGCCTCTGCCTGGTTCCTGG + Intergenic
901422588 1:9161215-9161237 AGAAGGCACAGCCTGGTTCAAGG + Intergenic
902794029 1:18788580-18788602 AGAAATTTCTGCCTGCTTCAAGG - Intergenic
903744402 1:25576978-25577000 AGGAGCTTCTGCCCGGTGCAGGG + Intergenic
904872335 1:33626501-33626523 GGAAGCCTCTGGCTGGTGCGAGG + Exonic
905776212 1:40668906-40668928 AGAAGCCTCTGCCAGGTGCTCGG - Intergenic
905907536 1:41628907-41628929 AGCAGCCTCAACCTAGTTCATGG - Exonic
905994645 1:42370964-42370986 ATAAACCTCTACCTGGTTCTAGG + Intergenic
907387337 1:54134517-54134539 AGCAGCCACTGCCTTCTTCAGGG + Intronic
908968517 1:69796459-69796481 AGAGGACTCTGTCTGGTTGATGG - Intronic
909924651 1:81425501-81425523 ACATGCCTATGCCTGGCTCATGG + Intronic
910258492 1:85273821-85273843 AGATCCCTCTGCCTGTTTCATGG - Intronic
910445486 1:87295467-87295489 AAAAGCATCTGCCTGGTACATGG - Intergenic
913307126 1:117441098-117441120 AGAAGCTTGTGCCTTGTTGAGGG + Intronic
913596563 1:120384572-120384594 TCAACTCTCTGCCTGGTTCACGG + Intergenic
914090707 1:144494410-144494432 TCAACTCTCTGCCTGGTTCACGG - Intergenic
914307900 1:146439805-146439827 TCAACTCTCTGCCTGGTTCACGG + Intergenic
914594209 1:149133328-149133350 TCAACTCTCTGCCTGGTTCACGG - Intergenic
915111028 1:153564785-153564807 TCAAGACTCTGCCTGGGTCATGG - Intronic
916512439 1:165484159-165484181 AGAAGCCTAGGTCTGGTTCCAGG + Intergenic
918468308 1:184844429-184844451 AAAAGCCTCTGACAAGTTCAAGG - Intronic
918761276 1:188412866-188412888 TGAAGCCCATGCCTGTTTCATGG - Intergenic
920187115 1:204166593-204166615 ATCAGCCTCTGCCTGCTCCAGGG - Intergenic
920316168 1:205076992-205077014 AGAAGCCTCTTCCTTATTCCAGG - Exonic
920345577 1:205303858-205303880 AGAAGCCTCCGCAAGCTTCAGGG - Exonic
923430638 1:233916811-233916833 TGAAGCCTCGGCCTCGTCCATGG - Intronic
924197938 1:241628151-241628173 AGAAGTCTCTGCCTTGTGCACGG - Intronic
1063108727 10:3016905-3016927 AGAAGTCTCAGCAGGGTTCAGGG + Intergenic
1065241411 10:23708795-23708817 AGATGACTCTTCCTAGTTCATGG + Intronic
1065442089 10:25763206-25763228 AGGAGCCTCTGCCTTTTTCCAGG + Intergenic
1067036827 10:42927006-42927028 GGAAGCCTCAGCCTGGTCCCAGG - Intergenic
1067190122 10:44061868-44061890 AGAAGCCTCTGTCAGGGTCGGGG - Intergenic
1067541314 10:47156584-47156606 AGAAGTCCCTGCCTGGATCAGGG - Intergenic
1069716445 10:70524122-70524144 AGCAGCTTGTGCCTGGTTGAGGG + Intronic
1071429866 10:85598728-85598750 AGAAGCCTGTCCTTGGTGCAGGG + Intergenic
1071958279 10:90782694-90782716 AGAAGCATCTCCATGGATCAGGG - Intronic
1072239438 10:93481680-93481702 AGCAGCGTCAGGCTGGTTCAAGG + Intronic
1072321100 10:94251014-94251036 AGAAGCCCCTTCCTGGAGCAGGG - Intronic
1073261888 10:102196669-102196691 GGTAGCCTTTGTCTGGTTCAGGG + Intergenic
1075529197 10:123213286-123213308 AGCAGCCCCTGCCTGAATCATGG - Intergenic
1076174275 10:128355109-128355131 TGAAGCCTCCACCTGGCTCATGG - Intergenic
1076440598 10:130478956-130478978 AGAAGGCACTGCCTCGTTCAAGG + Intergenic
1076654986 10:132018036-132018058 AGAAGCCTGGGCTGGGTTCAGGG + Intergenic
1076922407 10:133461189-133461211 AGAAGCCTGTGAGTGGGTCACGG + Intergenic
1077069071 11:659610-659632 AGGGGCCTCCGCCTGCTTCAGGG + Intronic
1077146455 11:1048509-1048531 TGAGGCCACTCCCTGGTTCACGG - Intergenic
1077273357 11:1692101-1692123 AGAATCTTCTGTCTGGGTCAGGG - Intergenic
1077898088 11:6469142-6469164 TGAAGCCTCTGTCTGGTGAAGGG + Intronic
1077917903 11:6622940-6622962 GGGGGCCTCTGCCTGGTTCCCGG - Exonic
1078339280 11:10487426-10487448 ACAAGCCTCAGACTGGCTCAGGG - Intronic
1081657990 11:44869939-44869961 AGAAGTCACTGCCAGTTTCAGGG - Intronic
1083626357 11:64073978-64074000 AGACGCCTCTGCCTTGTGCCTGG - Intronic
1083714306 11:64567071-64567093 AGCAGCCTGTGACTGGTTCATGG - Intronic
1085018385 11:73189967-73189989 GCAAGCTTCTGCCTGGTTCCTGG + Intergenic
1085794950 11:79530638-79530660 AGAAGCCTCTTCCTTCTTCTTGG + Intergenic
1088374008 11:109120531-109120553 ACAAGCCACAGCCTTGTTCAAGG - Intergenic
1088607618 11:111546522-111546544 GGCAGCCTGAGCCTGGTTCAAGG - Intronic
1089183759 11:116600886-116600908 TGCAGCCTCTGCTGGGTTCAAGG - Intergenic
1089806479 11:121095161-121095183 AGAAGCCTAAGCCTGGTGCATGG - Intergenic
1090846899 11:130537035-130537057 AGCAGACTCTGCCTGGATAAAGG - Intergenic
1090935258 11:131335844-131335866 TGCAACCTCTGCCTGGTTAAGGG + Intergenic
1091073461 11:132591265-132591287 AGAGCCACCTGCCTGGTTCAAGG - Intronic
1091391034 12:126069-126091 AGAGGCCTGTGGCTGGTCCAGGG - Intronic
1096981504 12:55730157-55730179 AGAAGCATCTTCCAGGATCACGG + Intergenic
1100423847 12:94463620-94463642 AGAAGCCACTGCCTAATTCAAGG - Intergenic
1101916068 12:108897041-108897063 AGATGCCTCTCTCTGGGTCATGG - Exonic
1102491947 12:113294776-113294798 AGAAGACTCTGCAGGGCTCATGG - Intronic
1104946635 12:132417566-132417588 CAAGGCCTCTGCCTGGTTCTTGG - Intergenic
1106040240 13:26083454-26083476 AGGAGCCACTGGCTGGTGCATGG - Intergenic
1106585133 13:31050646-31050668 AGAGCATTCTGCCTGGTTCAGGG + Intergenic
1106769022 13:32943996-32944018 GGGATCCTCTACCTGGTTCAAGG - Intergenic
1107623517 13:42258943-42258965 AGAAGTTTCTGCCTTGTGCACGG + Intergenic
1114300847 14:21375927-21375949 AGAAGGTTCTGCCTAATTCAAGG + Intronic
1116561096 14:46379484-46379506 AAAAGCCTTTGCCTGCTTCCAGG + Intergenic
1118444761 14:65840915-65840937 AGATCTCTCTGCCTGGTTTATGG + Intergenic
1118897077 14:69953952-69953974 AGAGGGCTCTGCTTCGTTCAAGG - Intronic
1119474374 14:74918673-74918695 AGAAGCCCCTGCCTGATGCCTGG - Intronic
1120422262 14:84302960-84302982 AGAAGCCACGGCCTGGAGCAGGG + Intergenic
1121831125 14:97053346-97053368 AGAAACCAGTGCCCGGTTCAGGG + Intergenic
1122124827 14:99573293-99573315 AGCCGGCTCTGCCTGGTGCATGG + Intronic
1122931865 14:104936776-104936798 AGATGCCCCTGCCAGATTCATGG - Exonic
1124808936 15:32914829-32914851 AGACTCCTCTGCCTGTTTCTGGG - Intronic
1126769585 15:52041757-52041779 AGAGGCCTCTGCCTTTTTTATGG + Intronic
1128384569 15:67138294-67138316 AGGGCCCTCTGCCTGGTTCTGGG + Intronic
1128899253 15:71404741-71404763 TGAAGGCTCTGCCTGCTTCATGG - Intronic
1129724019 15:77892477-77892499 AGAGACCTCTGCCAGGGTCAGGG - Intergenic
1132878545 16:2150819-2150841 AGATGGCCCTGCCTGGTTCCCGG + Intronic
1133152862 16:3850020-3850042 AGCAACCTCTACCAGGTTCACGG + Intronic
1134007547 16:10828219-10828241 CCAAGCCTCTTCCTGGCTCAGGG + Intergenic
1134049570 16:11127944-11127966 AGATGATTCTGCCTGTTTCAGGG + Intronic
1136353552 16:29728487-29728509 GGAAGCCTCTTCTTGGTTCGTGG + Intergenic
1137390552 16:48077803-48077825 AGAAGCCTCAGCGTGGTTTGTGG - Intergenic
1140822257 16:78673541-78673563 AGAAGCTTCTGGATGGTTGAAGG + Intronic
1140864009 16:79044023-79044045 CGAAGCCTCTTCCTGGCTCTAGG - Intronic
1143136969 17:4717512-4717534 CCAAGCCTCTGCCAGGTTCTGGG + Intronic
1143284068 17:5776201-5776223 AGAAGCCACTGCATGGCTCCAGG - Intronic
1144755134 17:17675471-17675493 AGAAGCCTCTGCCAGGGAAAGGG - Intergenic
1145747520 17:27331503-27331525 AGATGCCTCTGCCTGCATTATGG - Intergenic
1146271504 17:31488418-31488440 AGAAGCCGCTGCCAGGTGCGCGG + Intronic
1146373100 17:32277401-32277423 TGAAGCCTTGGCCTGGCTCATGG + Intronic
1147317952 17:39629781-39629803 ATAAGCCATGGCCTGGTTCAGGG - Intronic
1147649886 17:42055797-42055819 AGAAGCCTCTGGCTGCATCCTGG - Intronic
1147951656 17:44111086-44111108 ACCAGCCTCTCCCTGGTTCCTGG + Intronic
1148625241 17:49064387-49064409 AGATGCCTGGGCCTGGCTCATGG + Intergenic
1149687592 17:58545614-58545636 GGAAACCACTGCCTGGTACATGG + Intergenic
1150550686 17:66207002-66207024 AAAAGCCTGAGCTTGGTTCATGG + Intergenic
1151171009 17:72246250-72246272 AGAAGCTTGGGCTTGGTTCAGGG + Intergenic
1151207375 17:72517920-72517942 AGAAGCATCTGACTGGATCAGGG + Intergenic
1151978887 17:77497744-77497766 AGAAGCCTCAGCCAGGTGAAAGG - Intronic
1152405023 17:80092817-80092839 AGGAGCCTCTGCCTAGCTGAAGG + Intronic
1152844757 17:82592991-82593013 AAGAGCCTCTGCCCGGTACAGGG - Intronic
1152844793 17:82593192-82593214 AAGAGCCTCTGCCTGGCACAGGG - Intronic
1152844801 17:82593243-82593265 AAGAGCCTCTGCCTGGCACAGGG - Intronic
1153622570 18:6992993-6993015 AGATGTCTCTGCCAGGTACAAGG - Intronic
1156356515 18:36346681-36346703 AGAAGCCACCGCCAGGATCAGGG - Intronic
1156480384 18:37432685-37432707 AGAAGCTGCTTCCTGTTTCAGGG + Intronic
1156609002 18:38704089-38704111 AGAACCCACTGCCTGGAGCATGG + Intergenic
1157386477 18:47262882-47262904 AGAAGCTTCTCCCGGGTACAGGG - Intergenic
1160406865 18:78652375-78652397 AGTAGCCCCTGCCTGGTTTGGGG + Intergenic
1160872600 19:1283964-1283986 AGAAGCCCCCTCCTGCTTCAAGG - Intergenic
1160890630 19:1376949-1376971 AGAAGCGTCTGCCGTGATCATGG + Exonic
1161406731 19:4095091-4095113 AGAAGCCTCTGTCTGGTCCCCGG - Intronic
1162350135 19:10143699-10143721 AGAAGGCTCTGCCTGAAACAAGG - Intronic
1163294923 19:16405793-16405815 AGAAGCCTCTGCCCTCTTCTTGG - Intronic
1163799702 19:19356979-19357001 AGGAGCCTCTCCCTGCTACAGGG + Exonic
1164789760 19:30965883-30965905 TGAGGCCTCTGCCTTGATCAAGG - Intergenic
1165304290 19:34994235-34994257 AGAAGCGTCTCCCAGGGTCAGGG + Intergenic
1165595303 19:37007749-37007771 AGAAGCCTCTGCCTGACTTCCGG + Intergenic
1166532392 19:43550941-43550963 AGAAGCCCCTGCTTGGTGCCAGG - Intronic
1166735549 19:45082070-45082092 AGGATCCTCTGCCTGCTGCATGG - Intronic
1168375231 19:55871591-55871613 AGAAGCCTCTGTATTTTTCAGGG - Intronic
1168377095 19:55889399-55889421 AAAAGCCTGTTCCTGTTTCATGG + Intergenic
924979040 2:203576-203598 AAAAGCCCATGCCTGGTGCATGG - Intergenic
925130506 2:1490705-1490727 TGAAGCCTCTGCCAGGTTTGTGG - Intronic
925605260 2:5653934-5653956 TCAACTCTCTGCCTGGTTCACGG + Intergenic
925650728 2:6086461-6086483 AGCTGCCTCTGCCTGGCTCCTGG - Intergenic
926246175 2:11123664-11123686 GGGAGCCCCTGCCTGGCTCAGGG - Intergenic
927258998 2:21067948-21067970 TGAAGGCTCTGTCTGGGTCAGGG - Intergenic
927494169 2:23541393-23541415 AGAAGCCTCTGCCTGTCTTATGG + Intronic
930712586 2:54562965-54562987 AGAAAGCTCTGACTGGTACATGG - Intronic
932134309 2:69214853-69214875 AGAAACATCTGCCTGTGTCAAGG - Intronic
934985975 2:98884747-98884769 AGAGTCCCCTTCCTGGTTCATGG - Intronic
940365748 2:152846711-152846733 AGCAGGCCCTGCCTGGTTCCCGG - Intergenic
946167733 2:217875732-217875754 AGGAGCCTCTGCCTGGAGCCAGG - Intronic
948661863 2:239512213-239512235 CGAACCCACTTCCTGGTTCATGG - Intergenic
948723012 2:239913141-239913163 AGAAGGCTGGGCATGGTTCAGGG - Intronic
948913875 2:241020402-241020424 CGATGCCTGGGCCTGGTTCAAGG - Intronic
949065377 2:241987122-241987144 AGGAGCCGCTCCCTGGCTCAGGG + Intergenic
1170434267 20:16309002-16309024 AGAAGCCTCTGACTGACTGAGGG + Intronic
1170460179 20:16570432-16570454 AGACGCCTCTGCATTGATCACGG - Intronic
1170812638 20:19686453-19686475 AGAAGCTTCTGGCTGTTTCAGGG + Intronic
1171062641 20:21981267-21981289 AGAAGCCACTGTCTGATGCATGG - Intergenic
1171090511 20:22281682-22281704 AGAAACCTCTGCCTTGCACAAGG - Intergenic
1172158413 20:32846376-32846398 AGAAGCTTCTACATGTTTCAAGG + Intronic
1174399123 20:50266553-50266575 AGAAGACTCAGCCTGGTGCCTGG - Intergenic
1174457707 20:50661494-50661516 AAGAGCCTCTGCCTGCTTTAGGG - Intronic
1174564787 20:51456892-51456914 GGAAGCCTCTGGCTGGTGCACGG - Intronic
1174766635 20:53260537-53260559 AGGTGGCTCTGCCTGGTTCTGGG + Intronic
1175950936 20:62582654-62582676 AGAGGCCCCTGCCTTCTTCAAGG - Intergenic
1175963807 20:62650077-62650099 AGAAGCCGCTGCCTTTTCCAGGG + Intronic
1178102605 21:29286219-29286241 AGGACCCACTTCCTGGTTCATGG + Intronic
1178685992 21:34711080-34711102 AGAAGCCCATGCCTGGCTCTGGG + Intronic
1178857438 21:36262009-36262031 AGGAGCCTGTGCCTGGTTGTTGG - Intronic
1179579988 21:42336701-42336723 AGAAATCTCTGCCTAATTCAAGG - Intergenic
1180131404 21:45829389-45829411 AGCACCCTCTGCCTGGTCCCGGG - Intronic
1180731476 22:17985539-17985561 AGTAGCCTCTGCCTGGGGCGGGG + Intronic
1181324748 22:22036320-22036342 AGAAGCCTCTGCCGCACTCAGGG - Intergenic
1181516510 22:23416760-23416782 AGTAGCCTCTGCCTGGGGCGGGG + Intergenic
1182983832 22:34698226-34698248 CGAGGCCTCTGCCTGTTTCCTGG + Intergenic
1183021956 22:35034393-35034415 ATAAGCCTCTGCCTTGTTCCTGG - Intergenic
1183236707 22:36624238-36624260 AGAAGCCTCTGCCTGGTTCACGG - Intronic
1184147666 22:42620734-42620756 AGTAGACTCTTCCTGGTTCCAGG - Intronic
1184561405 22:45265250-45265272 AGAAGCCTCTGTCTAACTCAAGG - Intergenic
1184957207 22:47897281-47897303 AGAAACCTCTGCCTCTTCCAGGG - Intergenic
1185064056 22:48621848-48621870 AGAAGCCTCAGCCCGGAGCAGGG + Intronic
949097683 3:105607-105629 CGAAAACTCTGCCTGGTTGAGGG + Intergenic
949612657 3:5718792-5718814 AGAAGCATTTGCATGGTTCATGG + Intergenic
949893494 3:8751444-8751466 AGAAACCACTGCCTAATTCAAGG + Exonic
954095505 3:48323502-48323524 AGAAGGCTTTGCCTAATTCAAGG + Intronic
955227334 3:57071703-57071725 AGAAACCTTTGCCTGATGCAAGG - Intronic
955445352 3:59004287-59004309 AGAAGGCTCTTCCTGCTTCTTGG + Intronic
956695058 3:71911482-71911504 AGAAGCCTCTGCCTAATCTAAGG - Intergenic
960387156 3:117034249-117034271 AGAACCCTCTTCCGGGGTCAGGG + Intronic
962301245 3:134244962-134244984 AGAGCCCTCTTCCTGGTTTATGG - Intronic
962381697 3:134903429-134903451 AGAAGCCTCAGCTTGCCTCAAGG + Intronic
963054867 3:141177856-141177878 AGAAGCCTCTTCCTGCTTGTAGG - Intergenic
969997303 4:11326133-11326155 ACAAGCCACTGCCTGGCTCTGGG + Intergenic
970417026 4:15868807-15868829 AGGAGCCTCTGCTTGGAGCAAGG - Intergenic
971041586 4:22758573-22758595 AGAAGCCTCTGCAGTGGTCATGG - Intergenic
971197959 4:24487264-24487286 AGAACCCACTGCCTGGTGCTGGG - Intergenic
973540896 4:51934589-51934611 AGAAGCCTCTGCCCTGGGCAAGG - Intergenic
973977581 4:56278579-56278601 AGAAACCACTGCCTAATTCAAGG - Intronic
974753499 4:66172056-66172078 AGAAGCCTTTGCCTGGGTGCTGG - Intergenic
975974773 4:80082157-80082179 AGGATCGTCTTCCTGGTTCATGG + Intronic
976570385 4:86601048-86601070 TGATTTCTCTGCCTGGTTCAAGG + Intronic
978222683 4:106295666-106295688 AGAACCCCCTGCGTTGTTCAAGG - Intronic
980379934 4:132000523-132000545 AGAGCCCTCTTCCTGGTTCATGG - Intergenic
981092218 4:140743623-140743645 GGAAGCCCATGCCTGCTTCATGG - Intronic
984867558 4:184295050-184295072 AGAACCCGCTTCCTGGCTCATGG + Intergenic
985887950 5:2694806-2694828 AGCAGCCCCAGCCTGGTACATGG + Intergenic
992950330 5:81851810-81851832 GCAAGCCTCTGCCGGGTGCAGGG + Intergenic
992956298 5:81912088-81912110 AGAAGCCACTGCCTAATCCAAGG - Intergenic
994453369 5:99972756-99972778 AAAAGACTCTGCCTGCTTCAGGG + Intergenic
994854539 5:105099877-105099899 AGAAGCCCAAGCCTGGTGCAGGG + Intergenic
995397511 5:111702950-111702972 TAGACCCTCTGCCTGGTTCAGGG - Intronic
997641100 5:135449457-135449479 GGCAGCCTCCCCCTGGTTCAGGG - Exonic
998472089 5:142391362-142391384 AGAACCCCCTTCCAGGTTCAGGG - Intergenic
998643058 5:144033747-144033769 AGAAGCCTCTGCCTTTGTGATGG - Intergenic
999277727 5:150342823-150342845 AGAAGCTCCTGCAGGGTTCAGGG + Intergenic
1001698337 5:173689268-173689290 AAACGCCTCTTCCTGGTTCAGGG + Intergenic
1003189616 6:3862632-3862654 GGAAGCCACTGTCTGGTTCTGGG + Intergenic
1006439978 6:34047890-34047912 AGGAGCCTGTGGCTGGCTCAAGG - Intronic
1006629723 6:35422408-35422430 AGAAACTTCTGCCTGGCTCCTGG - Intronic
1007531512 6:42547243-42547265 AAAAGCCTCTATCTGGTCCAGGG - Intergenic
1009620238 6:66065556-66065578 AGAAGCCTCTCCTTCTTTCAGGG + Intergenic
1009976832 6:70680267-70680289 AGAATCCTCTGCTTAATTCAAGG - Intronic
1011744861 6:90399676-90399698 AGAAGACACTGTCTGGTTCCTGG - Intergenic
1011759971 6:90553144-90553166 AGAAGCATCAGGCTGGATCATGG - Intronic
1016042480 6:139445566-139445588 AGTAGGCTCAGCCTGGTTAAGGG + Intergenic
1018633336 6:165839592-165839614 AGCTTCCTCAGCCTGGTTCAAGG + Intronic
1018666679 6:166144867-166144889 ACTGGCCTCTGCCTGGTTCGAGG - Intergenic
1021131343 7:16916238-16916260 AGAAGCATCTGCCCGAGTCAAGG + Intergenic
1021457798 7:20848229-20848251 AGAAGCCTCTTTTTGTTTCAAGG + Intergenic
1023014856 7:35956622-35956644 AGAAGACACTGCCTGGTTCCTGG + Intergenic
1024006667 7:45229346-45229368 AGCAGCCTCTGCCTGGGGAAAGG + Intergenic
1024066149 7:45738398-45738420 AGAAGACACTGCCTGGTTTCTGG - Intergenic
1024201076 7:47106330-47106352 AAGAGCCTGTGTCTGGTTCATGG - Intergenic
1025217295 7:57069553-57069575 AGAAGACGCTGCCTGGTTCCTGG - Intergenic
1025628213 7:63243208-63243230 AGAAGACACTGCCTGGTTCCTGG - Intergenic
1025654053 7:63500910-63500932 AGAAGACGCTGCCTGGTTCCTGG + Intergenic
1030634911 7:111937876-111937898 AGGAGCGTCTGTCTGCTTCATGG + Intronic
1033641023 7:143263449-143263471 GGCAGCCTCTGCCGGGTTCCGGG + Exonic
1034120241 7:148620264-148620286 AGAAGCTTTTGCTGGGTTCAGGG - Intergenic
1034988747 7:155534158-155534180 AGGAGACTGTGCCTGGGTCAGGG - Intergenic
1035813834 8:2517143-2517165 AGAGGCCTCTGCCCGGTGCAGGG + Intergenic
1036685642 8:10908174-10908196 AGCAGCCTCTTCCTGGAGCATGG - Intronic
1038861799 8:31396070-31396092 AGAAGCCTCTACCAGGCTTAGGG - Intergenic
1041218659 8:55627047-55627069 AGAATTCTGTGCCTGCTTCAAGG + Intergenic
1042353811 8:67804266-67804288 AGAACCCTCTTCCTGGTTAGAGG + Intergenic
1042615721 8:70647002-70647024 TGAAGACACTGCCTGGTACATGG - Intronic
1042679585 8:71368062-71368084 AGTATCCTCTGCCTCTTTCAGGG + Intergenic
1047457964 8:125033532-125033554 AGAAATCTCTGCCTTCTTCAAGG - Intronic
1047803099 8:128330614-128330636 AGAAGCCAATGGCTGGTCCACGG + Intergenic
1048164489 8:132050410-132050432 ATAAGCCTCTTCCTGGGACATGG + Intronic
1048489748 8:134881641-134881663 AGAACAATCTGCCTTGTTCATGG + Intergenic
1048856729 8:138692922-138692944 AGCACCCTCTACCTGGTACAGGG + Intronic
1049283895 8:141764269-141764291 ACAAGGCTCTGCCTGGTGAAGGG + Intergenic
1049350449 8:142161555-142161577 ACATGCCCCTGCCTGGTGCACGG - Intergenic
1050991242 9:12155110-12155132 AAAAGCCTCTGTGTGCTTCATGG - Intergenic
1051187345 9:14474267-14474289 AGGGTCCTCTTCCTGGTTCATGG + Intergenic
1052348392 9:27433543-27433565 AGAATTCTCTGCCTTCTTCATGG + Intronic
1052747216 9:32452441-32452463 AGAACCCACTTTCTGGTTCACGG - Exonic
1052964835 9:34332151-34332173 TGAAGCCTCTGACTGGTTTTAGG - Intronic
1054957214 9:70926107-70926129 AGCAGCCTATGCATGGTTTATGG - Intronic
1055946093 9:81692228-81692250 AGAAGGCTCTGCCCTTTTCAAGG + Intergenic
1056971263 9:91206108-91206130 AGAAACCACTGCCTGATCCAAGG - Intergenic
1059538583 9:115108388-115108410 AGAAGCCAATGGATGGTTCAGGG - Intronic
1059937245 9:119323348-119323370 GGAAGCAACTGCCTAGTTCATGG + Intronic
1060557307 9:124514658-124514680 AGAAGCATCTGTCTGGGTCAAGG + Intergenic
1061627137 9:131847473-131847495 AGAAGCCTCTGCCTGGTTCAAGG - Intergenic
1061878731 9:133557780-133557802 AGGACCCACTGCCTGGGTCAGGG + Intronic
1061923553 9:133795125-133795147 AGGAGCCCATGCCTGCTTCATGG + Intronic
1186589743 X:10917447-10917469 AAAAGCACCTGCCTAGTTCAAGG + Intergenic
1188302449 X:28521771-28521793 AGAAGCCTCTGTATGGTTTTGGG - Intergenic
1190514604 X:51209942-51209964 ACAGTCCTCTGTCTGGTTCAGGG - Intergenic
1192541925 X:71981100-71981122 AGAAACCATTGCCTGATTCAAGG - Intergenic
1195554096 X:106201628-106201650 GAAAGCCCCTGCCTGGATCAGGG - Intronic
1197767092 X:130066436-130066458 ACAAACTTCTGCCTGGCTCAAGG + Exonic
1198320358 X:135513718-135513740 GGAAGCTTCTGCCTTCTTCAAGG + Intergenic
1199007340 X:142717022-142717044 AGAAACCACTGCCTAATTCATGG - Intergenic
1200078663 X:153564858-153564880 AGCAGCATCTGCCTGGTGTAAGG - Intronic