ID: 1061627138

View in Genome Browser
Species Human (GRCh38)
Location 9:131847480-131847502
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627138_1061627143 -5 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627143 9:131847498-131847520 CTTCTGTCTACACCCGGGGGTGG No data
1061627138_1061627144 -4 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627138_1061627152 15 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627152 9:131847518-131847540 TGGGTGGGGAGGGCTAGCTGAGG No data
1061627138_1061627141 -9 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627141 9:131847494-131847516 CTCTCTTCTGTCTACACCCGGGG No data
1061627138_1061627149 5 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627149 9:131847508-131847530 CACCCGGGGGTGGGTGGGGAGGG No data
1061627138_1061627148 4 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627148 9:131847507-131847529 ACACCCGGGGGTGGGTGGGGAGG No data
1061627138_1061627145 -1 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627145 9:131847502-131847524 TGTCTACACCCGGGGGTGGGTGG No data
1061627138_1061627153 23 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627153 9:131847526-131847548 GAGGGCTAGCTGAGGACCCACGG 0: 1
1: 0
2: 1
3: 11
4: 222
1061627138_1061627146 0 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627138_1061627140 -10 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627140 9:131847493-131847515 TCTCTCTTCTGTCTACACCCGGG No data
1061627138_1061627147 1 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627147 9:131847504-131847526 TCTACACCCGGGGGTGGGTGGGG No data
1061627138_1061627142 -8 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627142 9:131847495-131847517 TCTCTTCTGTCTACACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627138 Original CRISPR AGAAGAGAGAAGCCTCTGCC TGG (reversed) Intergenic