ID: 1061627139

View in Genome Browser
Species Human (GRCh38)
Location 9:131847492-131847514
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627137_1061627139 -4 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT No data
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data
1061627133_1061627139 10 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data
1061627134_1061627139 9 Left 1061627134 9:131847460-131847482 CCAAATCACGGTGCCTTGAACCA No data
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data
1061627132_1061627139 11 Left 1061627132 9:131847458-131847480 CCCCAAATCACGGTGCCTTGAAC No data
Right 1061627139 9:131847492-131847514 TTCTCTCTTCTGTCTACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627139 Original CRISPR TTCTCTCTTCTGTCTACACC CGG Intergenic