ID: 1061627144

View in Genome Browser
Species Human (GRCh38)
Location 9:131847499-131847521
Sequence TTCTGTCTACACCCGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627133_1061627144 17 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627137_1061627144 3 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT 0: 2
1: 0
2: 0
3: 27
4: 249
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627138_1061627144 -4 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627134_1061627144 16 Left 1061627134 9:131847460-131847482 CCAAATCACGGTGCCTTGAACCA No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data
1061627132_1061627144 18 Left 1061627132 9:131847458-131847480 CCCCAAATCACGGTGCCTTGAAC No data
Right 1061627144 9:131847499-131847521 TTCTGTCTACACCCGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627144 Original CRISPR TTCTGTCTACACCCGGGGGT GGG Intergenic
No off target data available for this crispr