ID: 1061627146

View in Genome Browser
Species Human (GRCh38)
Location 9:131847503-131847525
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061627138_1061627146 0 Left 1061627138 9:131847480-131847502 CCAGGCAGAGGCTTCTCTCTTCT No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627133_1061627146 21 Left 1061627133 9:131847459-131847481 CCCAAATCACGGTGCCTTGAACC No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627137_1061627146 7 Left 1061627137 9:131847473-131847495 CCTTGAACCAGGCAGAGGCTTCT No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627132_1061627146 22 Left 1061627132 9:131847458-131847480 CCCCAAATCACGGTGCCTTGAAC No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data
1061627134_1061627146 20 Left 1061627134 9:131847460-131847482 CCAAATCACGGTGCCTTGAACCA No data
Right 1061627146 9:131847503-131847525 GTCTACACCCGGGGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061627146 Original CRISPR GTCTACACCCGGGGGTGGGT GGG Intergenic